RSS

The code, the text and the language of God


By KatrinWeigmann

Article first published online: 9 JAN 2004; DOI: 10.1038/sj.embor.7400069

 

Introduction

Communication between scientists about their work is filled with images. This is inevitable when it comes to explaining complex ideas and concepts that are not directly observable, such as the subatomic particles that comprise a proton or an electron, or the processes inside a cell that lead to the correct formation of a protein. When new discoveries are made, the words to describe them are usually lacking and must be borrowed from the physical world or common speech: lipid rafts, chaperones, molecular markers. When scientists try to explain their findings to the public, or when the media try to make science more palatable to their readers or viewers, these metaphors become even more colourful: cells are factories, proteins carry zip codes, mitochondria are the power-house of the cell, and cells of the immune system go to school. As Harold Varmus said, “There’s a metaphor contest going on” (Angier, 2000).

Devising metaphors to explain complex concepts is a creative process and it reveals how scientists think and how ideas about a world too small to grasp are represented in their mind (Brown, 2003). However, metaphors, when carried too far, can convey a confusing or even misleading message to the public. They accentuate certain aspects of the subject or process they are depicting, while neglecting others. Some-times they even awake associations not intended by the author, when molecules suddenly acquire a personality of their own or are endowed with human goal-directed behaviour—take, for example, a molecule that ‘finds’ a partner or a cell that takes a developmental ‘decision’, such as committing ‘cell suicide’. Using molecular genetics as an example, I will try to follow some of biology’s metaphors from their origin in scientific communication into the real world and analyse their impact on the public perception of science.

Common language talks about DNA as ‘information’ or ‘a code’. For a very long time, scientists suspected that something—some kind of plan, specificity or driving force—resided within the sperm and/or egg, such that a snake developed from a snake egg and humans created human offspring. But it was only in the late 1940s and 1950s, when cyberneticists, physicists and mathematicians entered the field of molecular biology, that scientists came to interpret this ‘something’ as information. The physicist Erwin Schrödinger probably coined the term ‘code’ when he described living organisms in terms of their molecular and atomic structure, in his influential book What is Life (Schrödinger, 1944). The complete pattern of the future development of an organism and its function when mature, Schrödinger wrote, is contained in the chromosomes in the form of a ‘code’. His writings had a strong influence on both Francis Crick and James Watson and their later discovery of the structure of DNA. “Schrödinger probably wasn’t the first, but he was the first one I’d read to say that there must be a code of some kind that allowed molecules in cells to carry information,” Watson said in an interview with Scientific American (Watson, 2003). Indeed, Watson and Crick, in a paper on the implications of their DNA structure, picked up Schrödinger’s metaphor when they wrote that “it therefore seems likely that the precise sequence of the bases is the code which carries the genetical information.” From today’s perspective it seems rather inevitable that, when people started to think about the molecular basis of inheritance, they came up with these analogies. Although the metaphors seem so intuitive that it is hard for a geneticist to picture DNA as anything other than a code that transmits information, in her book Who Wrote the Book of Life, Lily E. Kay doubted that it is a natural property of DNA to be thought of as informational (Kay, 2000).

When H. Gobind Khorana, Marshall W. Nirenberg and other scientists revealed the trinucleotide code and the correlation between nucleic acids and proteins, this was referred to as ‘decoding’ or ‘deciphering’ the code. These metaphors have gained momentum and are now routinely used to describe the sequencing of the human genome. For the scientists involved, these references are clear by context—whether the issue is the DNA sequence itself or the relationship between DNA and protein. But news headlines such as “Decoding the book of life”, “Cracking the code of life” or “Breaking the code of life”, when referring to the sequencing of the human genome, are misleading to the layperson because they imply that the decoded text can be read like a novel. No scientist would dispute that this is far from the current state of the art. Understanding the message hidden in the 3 billion base pairs of the human genome would require a detailed translation of its sequence into physiological function. DNA itself is a “text without context” (Nelkin, 2001). Indeed, genes by themselves barely do anything. Genes just describe how to make proteins, or cease to make them, or regulate their production as directed by other proteins. Not even the basics of protein function at the level of protein folding can be deduced from the genes. It is not genes but intricate protein networks that constantly survey the environment outside the cell, monitor metabolic processes and integrate this information into physical function. Simply deciphering the text as laid down in the genome therefore does not necessarily predict how life works at the cellular, let alone at the organismal, level. Nonetheless, ‘decoding’ metaphors are used by the media and scientists alike, and have even reached industry: The company deCODE Genetics uses the slogan “decoding the language of life” on its corporate website. Through these metaphors, the lay-person perceives humankind as demystified, its secrets revealed.

From understanding the genome as a coded message, interpreting it as a text, book or language is not so far-fetched. These metaphors convey an important scientific principle: a sequence of a limited assortment of building blocks, like letters in a text, can carry a message. In his book The Language of Life, George Beadle wrote: “… the deciphering of the DNA code has revealed a language… as old as life itself, a language that is the most living language of all” (Beadle & Beadle, 1966). More recently, when scientists celebrated the completion of the first draft of the human genome in 2000, the ‘book’ and ‘language’ metaphors were revived—not just reinvented by the press in the service of the public understanding of science, but used by high-ranking scientists involved in the genome project to describe their achievement. On 26 June 2000, when Francis Collins, Director of the National Human Genome Research Institute, announced the completion of the first draft in a major media event at the White House, he said “Today, we celebrate the revelation of the first draft of the human book of life” and declared that this breakthrough lets humans for the first time read “our own instruction book.”

But what exactly do scientists mean when they say “book of life”? Collins has several explanations of its content, describing it as “a narrative of the journey of our species through time”, “a shop manual”, “a detailed blueprint”, and “a transformative textbook of medicine.” These explanations are confusing. The genome carries information that has developed through evolution and is translated into physiology by cells. Calling it a “narrative” or a “textbook” implies that it is written with intention and is meant to be read by humans. This confusion in intention and target audience misinterprets the role of scientists. Rather than describing them as outside observers trying to untangle the complexity of life, they are displayed as being part of the process, as the ones who are meant to read and interpret the message written down in the genome. But who is the author?

Francis Collins, at the White House event, was quick to give the answer and introduce another player into biological research. He referred to the sequence of the human genome as “our own instruction book, previously known only to God.” US President William J. Clinton similarly praised the scientists’ work, saying that “today, we are learning the language in which God created life.” At a press conference the following year, Collins carried his reference to God even further: “But we are also profoundly humbled by the privilege of turning the pages that describe the miracle of human life, written in the mysterious language of all the ages, the language of God.”

In his remarks, Collins not only further confused the message to the public about the real implications of knowing the human genome sequence, but he might even have done science a disservice. According to his remarks, the text of the genome was written by God, in His language. If we follow this belief further, it implies that God is actually talking to humans through the genome, with the scientist being the mediator between God and the rest of the world. This metaphor definitely does not convey a scientific concept and falsely attributes to scientists a role as priests who read God’s instructions and translate and interpret them for the public. This serves neither science nor religion. From a religious point of view, this could very well amount to blasphemy. From science’s point of view, it could further damage the role of science, because it introduces some higher being’s will and intentions into the scientific exercise, after centuries of attempting to free science and research from the limits imposed by religious leaders. In the best case, it provokes sarcasm: “And in the Human Genome, Chromosomes Chapter IXX, the Lord speaks to us of His divine plan, saying, ‘cggggggcccggagcgggat…’” (Franks, 2002). In the worst case, it provokes public fear—the idea of the scientists ‘playing God’ is not too unbelievable. And the public does listen to what the scientists are saying—indeed, public attention to the genome project was unrivalled. In 2000, The New York Times alone published 108 articles related to the Human Genome Project. Was it this outburst in media attention that turned scientists into PR spokesmen and encouraged them to blow their speech out of proportion?

It is a common misconception that metaphors are used only when addressing or explaining scientific concepts to the public, whereas communication between scientists is purely objective. Thinking of genes as ‘controlling’ or ‘programming’ development—common metaphors used in developmental biology—dictates a certain view of these processes that might not reflect the whole truth, and disguises other aspects. The consequences for this area of research are discussed elsewhere (Nijhout, 1990). The use of metaphors in the public discourse affects public understanding, and eventually public acceptance, of science and technology. In general, there are two levels of metaphor misuse: metaphors blurring the scientific concept they are supposed to clarify, and metaphors that awake unintended associations and mislead public understanding.

A common symptom of metaphors blurring a scientific concept is their appearance in large numbers and high density. Excessive use of metaphors does little to clarify the science behind them because their explanatory value is not additive. “This map will describe for us the exact content and structure, not only of each and every gene associated with a species, but also the precoded information, or ‘chemical spelling’ that controls when a particular gene is turned ‘on’ or ‘off’” (Venter & Cohen, 1997). This swamp of verbosity contains four or five metaphors, but it is nonetheless—or rather because of this—hard to grasp. Even someone with a background knowledge of molecular biology will not be able to grasp the sense of this sentence easily and without rereading. It just seems impossible to think of DNA as a map, information (encompassing both content and structure), a code (or rather a pre-code), a text and a chemical structure, all at the same time. The lay reader is overwhelmed with an impression of impact, meaning, prominence, significance and seriousness, but deprived of any means to understand what exactly has been said. If this is an attempt to further public understanding of biological research, it has failed and could well contribute further to the image of scientists as practitioners who are unable to explain their work in simple and easily understandable terms.

Moreover, the inconsiderate use of metaphors that promote confusion can also lead to misconceptions. Genetic metaphors often convey the impression that there is much more potential or many more implications in genetics and genomics than is really so. This, of course, may be profitable in fundraising, but is counterproductive in conveying credibility or fostering public acceptance. The exaggeration of the potential of molecular genetics is achieved by overemphasizing the power of the gene and also that of the scientist analysing it. Walter Gilbert, Professor in the Department of Molecular and Cellular Biology at Harvard University (Boston, MA, USA), has introduced public lectures by pulling a CD from his pocket and saying, “This is you” (Nelkin, 2001). This is a gross overinterpretation of the genome’s role in our development and completely neglects the importance of environmental factors on the formation of the individual. Similarly, “reading, from cover to cover, the first draft of this ‘Book of Life’”, as Collins put it, is not exactly what scientists are now capable of doing. Rather, they are trying to infer some meaning from small individual chunks of text. The combination of these two powerful metaphors supports the idea that the essence of mankind is a DNA sequence and that scientists are about to disclose it—to read it “from cover to cover”. Taken a little bit further, it means that human beings are deprived of all their mysteries and secrets, as their DNA can be analysed and manipulated at the whim of the scientists, who are therefore taking over God’s part in human evolution. Indiscriminate use of these metaphors provokes fear and disapproval in the public, which we have already witnessed in the various public debates on prenatal genetic diagnosis, gene patenting, the use of genomic markers to predict predisposition to disease, and the use of DNA to identify individuals. These increasing concerns could in turn encourage scientists to explain their work in even blunter terms, with even more penetrative power, creating more fear and resistance among the public—a vicious circle. This is not to say that scientists should start communicating to the public in purely scientific terms—metaphors have an important role in helping the public to understand and eventually accept science. But they should become more aware of the nature of metaphors and the images they create in the reader’s or listener’s mind, and should not use them indiscriminately or in an exaggerated way. As our parents used to tell us when we were children: “Watch your language!”

 

References

Angier N (2000) A pearl and a hodgepodge: human DNA. New York Times, 27 June, p1

Beadle G, Beadle M (1966) The Language of Life. Doubleday, New York, USA

Brown TL (2003) The art of the scientific metaphor. Scientist17: 10 | ISI |

Franks G (2002) The language of God. http://www.purewatergazette.net/, 22 February

Kay LE (2000) Who Wrote the Book of Life? Stanford University Press, Stanford, California, USA

Nelkin N (2001) Molecular metaphors: the gene in popular discourse. Nat Rev Genet2: 555–559

Nijhout HF (1990) Metaphors and the role of genes in development. BioEssays12: 441–446

Schrödinger E (1944) What is Life? Cambridge University Press, Cambridge, UK

Venter C, Cohen D (1997) Genetic code breakers. Weekend Australian, 19 July, p28

Watson JD (2003) A conversation with James D. Watson. Sci Am288: 66–69

   

                                                          

Author

KatrinWeigmann is at the press relations office of the DFG Research Center for Molecular Physiology of the Brain in Göttingen, Germany.
E-mail: kweigma@gwdg.de

 

Link: http://onlinelibrary.wiley.com/doi/10.1038/sj.embor.7400069/full

 
 

Teaching science: Realism, Anti-realism and the construction of the concept of oxygen


Author: Marcos Rodrigues da Silva, Professor-associado/Universidade Estadual de Londrina. Rodovia Celso Garcia Cid PR 445 km 380 – 86057-970 – Londrina – PR – Brazil.mrs.marcos@uel.br 

ABSTRACT
Research in science education have pointed out the importance of a discussion about the nature of science. One way to convey a more real nature of science teachers would adopt a philosophical attitude about the concepts that denote unobservable entities. In the case of concepts already abandoned by scientific theories – such as phlogiston – is common to present that were discarded because nothing represented empirically. However, at the time of using the concept of phlogiston, he formed part of a network that was theoretical and explanatory justified its adoption. This article takes the view that the adoption of philosophical positions towards scientific concepts must be supported by knowledge of the history of the concept.

Research in science education have pointed out the importance of a discussion of what is called ‘nature of science’. The term covers a wide range of topics: understanding the inner and outer workings of science (Scheid, Ferrari, Delizoicov, 2007, p.158); improvement of ideas of students and teachers (Oki, Moradillo, 2008, p.71); establishment and modification of epistemological conceptions of teachers (Beach, Gil-Perez, Vilches, 2007, p.147); scientific and technological literacy (Acevedo et al., 2005, p.4); understanding of the history of science as a relevant source for understanding the nature of science (Matthews, 1994, p.50-52); understanding of theoretical aspects of science, so that these aspects do understand your practice (Fourez, 2003, p.118); structuring of experiments and observations in broader conceptual schemes, or “paradigms of thought” (Lonsbury, Ellis, 2002, p.3). And these topics, we can infer is the concern with scientific training in the broad sense. So if you want the scientific training includes a scientific literacy teacher and student, and that, beyond the content itself, seize these other aspects that are linked to the content, which, so to speak, constitute somehow . In this article the discussion about the nature of science prioritize the role of history of science in education.

One of the main issues related to the problem of understanding the nature of science concerns the image of her that is conveyed by teachers. This image (reflected especially in textbooks) often has as elements the concepts that it (a) is fundamentally an experimental activity, (b) is progressive (if ever closer to the truth) and (c) is an activity-guided methodology (universally accepted) well defined. The whole problem is that historians, sociologists, psychologists and philosophers of science have insisted on reporting this image ‘not always’ reflects the actual practices of scientists, or even that our attempts to understand the actual practices of scientists produce results too modest to one can use the expression ‘actual practices’.

In this article I’ll stop in element (c) above: the methodological element of our popular image of science. This element receives an input epistemological another element that was not mentioned: fallibilism.1 Currently you can see that is already part of our common sense scientific conception that scientific theories can be replaced by theories that judge better than the previous ones. And as we proceed in this-substitution? By using a scientific method that allows us to clearly point out that a theory is superior to another. Now, one of the natural consequences of replacing a theory is that certain other entities, mechanisms and processes that formed the scientific ontology2 theory replaced disappear. Thus, Copernicus does not use the notion of epicycles Ptolemy, Galileo did not use the Aristotelian notion of natural place, Darwin does not adopt the conception of a divine plan; Lavoisier does not accept the existence of phlogiston etc.. Such substitutions would be legitimated by the use of a reliable method that would allow us to, ‘after the substitution has occurred’, say that our ancestors were mistaken considerably. In this conception, to be criticized in this article, men like Galileo and Lavoiser have shown us the ‘right way’ to be followed, involving the elimination of so-called unobservable entities’, ie, entities that have been postulated by theories (and were part its ontology) but which, upon removal of theories have also been eliminated.

But one could argue: if an error occurred in the past, maybe there in the future also.3 And if this argument is valid, who knows what is best to adopt a modest stance regarding the admission of new scientific entities.Perhaps today there are also unobservable, argue a teacher and philosophical historiographically instructed.4The picture is clear: one can argue for the existence of the entities that populate the universe of current theories, on the other hand one can argue that they may not exist. The game takes place these arguments in a forum specific philosophical: the debate realism / antirrealismo.

According to Michael Matthews (1994, p.163) would be useful for teachers and students realize that this debate is central to understanding the nature of science. This is because such teachers would be responding to her students the following question: scientific concepts are names of entities and real processes (ie, make up the ontology of a theory) or are just fictions (ie, only part of the mental constructs of theory)? Generally speaking, scientific realists respond that we can infer the existence of the entities named by concepts; antirrealistas now argue that we can not claim that scientific concepts denote processes independent of theories.5 In the specific case of the problem that will be examined in this article, we want to know if the science teacher adopts a realistic or antirrealista about the theories that teaches its students. Students are taught true theories or fictions and built the formal point of view? Students are taught about the real processes of nature or just fancy ways of dealing with nature? For Michael Matthews, understand the nature of science is a task which no educator could escape.6 So far everything seems very plausible, and a philosophical point of view, quite civilized. But would such as didactic interventions from what was established in the preceding paragraphs? Think from an imaginary example. Professor realistic, of course, emphasize that the transmission of hereditary information occurs by action of, among others, genes – which actually exist. Professor antirrealista say that such transmissions occur because of biological units (genes) that we do not know for sure whether or not there. The situation seems curious, because the teacher realistic then behave more or less like someone who says your tire fitter: arrange the tire of my car: the tire there, the car also! But Professor antirrealista would have to say: I do not know if there are the right tire and car, but just in case fix it the same way. Both seem to give the impression that philosophy is a luxury only rhetorical, an intellectual position that – with regard to science teaching – can maximum satisfy certain whims epistemological that perhaps someone may have. In this sense everything suggests that ‘from the point of view of science education’, there is not much sense in taking seriously the controversy realism / antirrealismo.

Michael Matthews seems to be quite aware of the risk of the discussion realism / antirrealismo flowing into the intellectual vacuum in the previous paragraph. So much so that he claims that “approach the subject from contrasts so limited would not appreciate the nuances of the story” (1994, p.174). The ‘limited contrast’, of course, would be the intransigence ontological genes exist (for realists) or no (for antirrealistas). This contrast prevents a better understanding of the ‘nuances of the story’. But what would these nuances? Matthews recalls the old opposition between empiricism (antirrealista) Mach and Einstein realism about the existence of the atom. It would be a mistake, says Matthews (1994, p.174), describing the opposition as simply, as the real story of the episode certainly deserves more than ontological statements (“the atom exists”, “the atom does not exist” .)

This article aims to explore the field of discussion realism / antirrealismo in science education from the historiographical orientation of Matthews. Try to show that this discussion is not only a way to establish ontological verdicts. It can also be an extremely useful tool, in conjunction with the history of science, ‘understand’ something about the nature of science. This is because the history of science reveals that in several episodes, not always the most important was the inference of the existence of entities and processes now widely accepted by the scientific community. My strategy will be to show, by means of an episode in the history of science – the construction of the concept of oxygen – which is not always the discussion about the existence of entities and processes is the most important discussion. In so doing, ie, by not putting in the foreground the ontological discussion at hand, scientists seem to give the impression that whether an entity or process is not exactly the most important issue from the point of view of theory building scientific explanatory. In reviewing this episode we see that, at least in it, rather than whether certain entities and processes exist (or not), which told the scientists involved in it was the construction of hypotheses that effectively explain phenomena that should be explained. Thus, presenting the problem of whether the entities and processes described by the best scientific theories indeed exist in a form of ‘yes or no’ does not appear ‘in the light of this episode,’ do justice to the actual procedures adopted and used by scientists. And with that, the requirement that a science teacher adopt a realistic stance or antirrealista sounds like an extremely complex requirement, if that teacher is not aware of the content of the story that he teaches. That is, there is the case of demanding then the teacher has only one philosophical stance on the issue, but also knowledge of history (what for which he will take a philosophical position). Therefore understanding the nature of science, in this case, is to understand a series of interrelated aspects to the ontological question – aspects which I hope to show, are equally or more important than the actual ontological question.

This article presents, in the first section, the importance of the discussion about the nature of science. Then – through the outline of a case study of the history of chemistry – show that one aspect of the discussion about the nature of science – the question of the existence of scientific entities – can be addressed in a more profitable with the use of history of science . In the third section of the paper I argue in favor of emphasis on explaining the science; aspects which seem most relevant to an understanding of the nature of science than the ontological aspects. Finally, in conclusion, I argue that discuss the problem of the nature of science is both have limitations that seem inherent in the form of construction of scientific objects.

This article is the result of research in philosophy of science from historiographical approaches, research which falls also in discussions about science education.

THE NATURE OF SCIENCE

One of the strongest claims of theorists of science education regard to obtaining an insight into the ‘nature of science’. The expression ‘nature of science’ undeniably covers a wide range of meanings, and certainly would go beyond purely scientific aspects of the production and justification of science, since it should also refer to social science. However, for this article, we will use the term as denoting the internal aspects of science.7

From the theoretical point of view, what kind of knowledge would be drawn from an investigation into the nature of science? It could be argued that it is a metacognition, that is, something that hangs above the own knowledge produced by science. For Acevedo et al. (2005, p.2) obtaining their metacognition revealed an ambitious goal. Pertinently, the authors call for the teaching of science some answers to certain questions, one of which is: “what kind of science we mean [the nature of science [?” (P.7). For them, science is a polysemic concept, since it refers to various forms of activities, and thus can not identify “academic science” (p.7) with “macrociência” (p.7), which was an activity that includes the Army and industry; authors also point out that the debates about the nature of science in general focus on academic science (p.6).

The general methodology of work points to an aspect that we share with Acevedo et al. (2005). As the authors problematize obtaining a conception of the nature of science restricted to ‘academic science’, this article discusses the view that the conceptions about the nature of science may derive from a position opposite the philosophical debate realism / antirrealismo. This is because the result of such a pronouncement can provide an image of science that ignores the complexities of the history of the concept (or theory) to be defending as ‘real’ (realist position) or as ‘fiction’ (position antirrealista). And an image of science that does not reflect the complexity of scientific (academic) may undoubtedly miss some important aspects of building certain concepts and theories that are now established.

Before seeking to develop this point (development that will actually be done only in the next section) would like to explore further the complexity of scientific activity, since, by assuming its existence, more easily realize that philosophical attitudes about acceptance of scientific theories and entities ‘may’ be sterile when dissociated conceptions about how emerges a theory or concept. Likewise, scientists attribute to the adoption of certain research methodologies and certain attitudes axiological order to explain the emergence of the theory proposed by them without at the same time, take into consideration the circumstances (in the case of our article, scientific circumstances ) that led her to propose conceptual scheme ‘may’ be a way to truncate a conception of the nature of science that otherwise would prove a bit richer and therefore more useful for the assessment of science. So it seems important to hold some meaning in the complexity previously mentioned.

The complexity identified seems to result from the complexity of the science itself, especially with regard to the mode of construction of scientific knowledge. Why is it so difficult to say that a scientist proceeded inductively or deductively? Why is it so complex to say the first scientist built a hypothesis and then tested or auditioned first and then built a theory? These issues are complex, given that we can not always reconstruct historiographically such steps in an orderly way, since science, like any human endeavor is not always constructed so commanded.

According to Singer (1989, p.159) notes lab scientists reveal clues that there are discrepancies between what scientists actually did and what they reported in their publications; yet for this author (p.160), this count as evidence that personal notes and literary publications are vehicles that have distinct forms, as well as their goals are distinct and conventions that govern them. As for Lewontin (1998, p.108), scientific journals standardized scientific publications to require certain sequence of items (introduction, methods and materials, discussion, results, conclusion and summary). To him, the whole importance lies in its ‘results’ that reveal ‘that speaks for itself’, ie, the empirical results, which confirm the theory.

One way of ordering the chaos is to establish a methodology of analysis for a certain problem. Say we are interested – as in the case of this article – to understand the dynamics of acceptance of scientific entities. In this case we can think as follows: certain periods of science reveal disputes about the existence of certain entities, such periods are followed by another period in which disputes no longer occur. The question is: why disputes occur no more? One answer (which will not be of this article, as will be seen below) would be: the dispute is not because one of the contenders emerged victorious, with his victory the expression of truth about nature. Thus, phlogiston was declared nonexistent because in fact did not exist. The problem with this methodological approach is that it makes such disputes in a discussion as to whether or not there is a cat on the roof of the house, I hear noises on the roof, climb to the roof and can not find a cat, but a loose tile, can then declare that there is no cat on the roof. But science proceeds in this way? Probably not. And then someone could reply, but then how comes? Here is the point. It would be reasonable to try to answer satisfactorily the last question? As we? Indeed, it is this gigantic task that is being carried out by philosophers, sociologists, historians, psychologists etc..: Understanding the dynamics and structure of scientific knowledge production. This understanding, in turn, reveals considerable difficulties. These difficulties arise primarily according to the peculiarities of each scientific episode. So, how to apply wide-ranging philosophical methodologies to assess episodes that are private in nature (Feyerbend, 1996, p.96-99)?

A clear example of these difficulties can be encountered when trying to understand the history of science using the schema cyclic Thomas Kuhn (1970). As we know, Kuhn divides the history of a scientific discipline in four basic stages: (a) a stage in which there is no consensus on the fundamentals of a science (pre-normal science), (b) a stage in which the scientific community is consistent with respect to key aspects of a science (normal science), (c) a period in which science is well established in (b) is under suspicion of some members of the scientific community (crisis), (d) scientific revolution: given the mistrust, the foundations of (b) are shaken and there is a new period of normality from new fundamentals and scientific problems. While scheme, the proposed Kuhn may prove a guide to interesting historiographical research, but is that all science can fit point to point in this scheme? Furthermore, the schema is also summarized. In this sense, it is evident that a methodology of historical analysis has limitations in its application. The same, the principle applies to any scheme. The limitation is also, in turn, an indication of the wealth of science. And this wealth dynamics of science shows that it is not a simple task to introduce, for example, the ontological commitments of scientists, as well as the role that such commitments occupy in their investigations, at least not if such commitments are evaluated outside its original context. So if it is true that one of the important aspects of nature of science is the ontological dimension (in fact scientists are committed to the existence of entities), it is no less true that this dimension is located in a wider network. And with that, the record that the ontological dimension is a fundamental aspect of the nature of science could not be done without simultaneously remember that this aspect is not isolated nature of science.

What we are suggesting is to answer yes or no to the question “such an entity exist?” is insufficient to adequately understand the ontological aspect of the discussion about the nature of science. And is insufficient considering that, at least for the episode that will be examined in this article, not always the scientists are ‘primarily’ interested in ontological questions. Sometimes this interest ‘may’ be secondary. For the episode of the discovery of oxygen, there is strong evidence that historiographical Lavoisier clearly avoided discussing the problem of non-existence of phlogiston, as discussed below. Instead, he sought to systematically build a viable alternative to the theory of phlogiston – alternative, of course, would also ultimately lead to new chemical does not work with phlogiston.

Thus the return to the history of science can be an expedient very useful for understanding the nature of science from the viewpoint of the cognitive significance of theories, but what do we find in this return? It is difficult to say that we will not find scientists obeying the rules of introduction and admission of scientific concepts, but it is also very difficult to find them with the clarity that if you like. However, from the point of view of science education, it is appropriate (to say the least) show the difficulties encountered by scientists to introduce new concepts (or reformulate old). More than that: the point of view of understanding the nature of science is important that teachers are clear that such difficulties scientists emerged in view of the problems arising from the internal structuring of the conceptual network as a whole. Thus, a conception of the nature of science could emerge from this discussion, with handsome dividends teachers.

THE CONSTRUCTION OF THE CONCEPT OF OXYGEN8

The history of chemistry, in the period before Lavoisier (around the late sixteenth and early seventeenth century), the proposal and maintain records of the phlogiston theory. According to this theory, among the principles governing changes of state of the bodies found itself the principle of flammability, phlogiston. When was the burning body changed state because releasing phlogiston. The ash from burning were nothing more than the production of a chemical change in which the originating body (a piece of wood, for example) has released its share of phlogiston and, thus, became gray. A similar process occurred with the rusting (oxidation): rust was the result of the release, by the metal, its phlogiston, albeit slower. According to the chief defender of the phlogiston theory, Georg Stahl, combustion and rusting obey the same chemical processes, albeit at different speeds. In short: the explanation for both phenomena was found on the same principles.

The term phlogiston theory was intended by its users as denotador a substance that, at first, was lacking in referentiality. Where was the phlogiston? The phlogiston was not gray and rust, but a principle that became gray and rust. In burning, it was assumed that this principle was evading flammable (Leicester, 1971, p.120). Well, if it were true that phlogiston was being released from burning and rusting, then it should be possible to say something about its properties.

An extremely interesting historiographical discussion proposed here is that fool who thought that the discussion revolved only around the properties of phlogiston.

Here we enter an interesting point for debate realism / antirrealismo. One thing is to say that ‘theory’ phlogiston ‘explain’ phenomena, and another is to say that a central term of this theory – phlogiston – ‘has empirical reference’, it is important to remember that the history of science, a work conjunction with the philosophy of science, reveals the existence of a certain tolerance of the scientific community with postulated entities (Kuhn, 1970, p.127-128). In the case of phlogiston, it was contained in a theory which, in his time, explained so successful why certain phenomena behaved the way they behaved (Leicester, 1971, p.123, Smith, 1981, p.113) . In a philosophical model that privileges the problem of scientific explanation there is no reason to be offended – at least preliminarily – the question of the absence of empirical reference to the alleged entity phlogiston. Tolerance, however, is not unlimited or unconditional. Once established a theory, it follows a work of improvement and sophistication of the theoretical apparatus originally proposed. Presupposed the phlogiston theory as an explanation, should succeed work to identify the effects – and ‘only’ effects – its supposed existence as a principle (Leicester, 1971, p.123). Thus, one of the important issues of that time concerned the role of air in combustion. It would be just the vehicle propagation phlogiston or would play a role in chemical combustion?

One of the scientists who held a prominent role in the discovery of the chemical on the gas and the air was Joseph Priestley. During its investigations, it came to designing a ‘desflogistizado air': combustion would be a quick process because releasing an equally rapid phlogiston. The air present in the combustion air was a pure air that contained no more inflammable principle of bodies, an air containing no more phlogiston, already released in combustion. However, what would be the point of view of the formation of a new concept, the ‘air desflogistizado’? For sure it was a novelty, however, its scope was not broad enough to exclude (not desired by Priestley) the concept of phlogiston chemistry. Indeed, state that air does not contain flogisto is still moving within an area containing the theoretical concept of flogisto.9 And in the empirical domain, an air desflogistizado is an air that does not contain a substance that is somewhere else. If we follow the guidance of Priestley, phlogiston is still a relevant concept for understanding certain chemical processes. Here, in fact, what happened was that Priestley discovered oxygen – almost simultaneously with the discovery of this element by Carl Scheele – and called coherently of ‘air desflogistizado’. This season marks the end of the theory of flo-gisto and records the emergence of Lavoisier in chemistry. The French chemist opposed the phlogiston theory from the beginning of their work. It is interesting to note, briefly, as Lavoisier built his opposition to this theory, especially with respect to its theoretical caution.10

According to Paul Thagard, one must take into account that the attack of the phlogiston Lavoisier should be understood only as a part of its production, which resulted in the creation and dissemination of a new system of chemistry. Thus, Thagard examines, from the works of several historians, movements Lavoisier since his initial experiments until its proposed explanation of the phenomena of combustion and oxidation. Initially the opposition of Lavoisier’s theory of phlogiston is marked by a tendency experimental, this time culminating in 1772, with a note addressed to the French Academy in which he reported his experiments weighing of phosphorus and sulfur after combustion and emphasizes they were heavier after the process (Leicester, 1971, p.140-141, Partington, 1937, p.125). Also points to an explanation for the process: the presence of air. The air was pure agent who joined the metal making them heavier. Here already, so surreptitious, a critique of the concept of phlogiston: if the body became heavier after firing, so he has not lost phlogiston. However, no experimental evidence corresponds to a theoretical formulation also more robust concerning the properties of air and the absence of this theory Lavoisier leads to doubt about the potential explanations for their chemical processes in question, which leads Thagard (2007, p. 276) stated that

he is still not very confident that you have a strong alternative to the phlogiston theory of Stahl, it states that the current state of knowledge on the calcination and reduction does not allow us to decide between his interpretation and phlogiston, and that opinion Stahl may be compatible with your. In 1776, Lavoisier admits in correspondence, which often have more confidence in the ideas of the eminent English theoretical phlogiston – Joseph Priestley – than in their own ideas.

A second phase takes place around 1777, when Lavoisier address the problem the first time, namely, the problem of identifying more precisely the properties of air involved in combustion. Lavoisier presents the idea that the air is atmospheric air ingredient, and that air combines with the metals is a mixture of two components (Leicester, 1971, p.142). The problem is that this development is still inside the structure phlogiston, as Priestley also is one of the scientists who are working on research on the air. Priestley also reached the conception of a pure air, and the air in the structure phlogiston, was not exactly an air phlogiston. At that time, 1778, Lavoisier publishes another article reporting their research. In this statement he shows some impatience with the failure of some scientists to isolate phlogiston and suggests that, according to Thagard (2007, p.277), “even though they may abandon the phlogiston theory,” the hypothesis that the combination of the air with the metals is less artificial and contradictory than the phlogiston theory. Thus, it is only in this second moment Lavoisier admits that the phlogiston theory to be inferior to another alternative. The third and decisive moment occurs around 1783. At this time Lavoisier begins to use the term ‘oxygen’. Additionally first suggests that “since the theory of oxygen is higher than flogisto theory” (Thagard, 2007, p.278-280), then it is unlikely that there flogisto. Therefore, according to Thagard, replace the phlogiston theory was simultaneously proposing a new alternative explanatory. But note that we are not talking about phlogiston itself, but the theory that the houses.11

Realize chaining these three moments can be enlightening to understand the debate realism / antirrealismo and their implications for teaching. You can see that the episode suggests much the occurrence of a struggle for explanations of the phenomena of the occurrence of ontological disputes. Lavoisier avoids the non-existence of phlogiston, and even when it is suggested, has a view to explaining the superiority rival the phlogiston theory (Thagard, 2007, p.278). Thus, the history of chemistry reveals in fact a dispute – but the nature of this dispute?Again the story of the episode comes to our aid. One of the strengths of the system Lavoisier did not occur in the field trial itself, because there was no question that metals gained weight during combustion – only in the period in which the phlogiston theory of fenecia fact is that questioning was experimental, with the statement that phlogiston had negative weight (Thagard, 1978, p.78). Questioned the importance of the concept of weight to explain what should be explained, which is a strategy fully justified the methodological point of view (Laudan, 1977, p.84). Ie, it was possible that the phlogiston theorists would lead to dispute not for testing ground, but for the methodological domain.

What is important to note is that the introduction of the concept of oxygen by Lavoisier was not the introduction of a single entity, but rather that entity had to be assimilated within a ‘new’ theoretical network (Kuhn, 1970). Even because the concept of oxygen, by itself, could be interpreted – as indeed it was by Priestley – as a concept of phlogiston theory because the evidence could be assimilated by this theory. The truth is that Lavoisier needed theoretical principles robust enough to constitute a theoretical manner alternative to the theory of phlogiston. He needed to weave a theoretical network to rival the phlogiston theory and will impose methodological standards and explanatory unattainable.12 Perhaps this was more decisive for the success of Lavoisier than their experimental and methodological achievements, which were actually playing the experimental work of other chemicals (Partington, 1937, p.122). Even his demand for a quantitative approach in chemistry was derived from other chemicals, such as Robert Boyle and Joseph Black (Partington, 1937, p.124), and had already been adopted by Cavendish (Ladyman, 2002, p.7). Lavoisier built a new explanatory theory, can be considered a new ‘form’ of explanation, because the new concepts introduced by him not only replaced the old (like phlogiston), but also established new connections between all the theoretical network would be structured to provide explanation of calcification and combustion (Thagard, 2007, p.184). To get just one example: the theory of phlogiston, phlogiston itself and oxides were components of metals, whereas the theory of Lavoisier, oxygen and metal oxides formed, it is realized that, in addition to the elimination of some concepts (like phlogiston), there was also a new mount for the structure. In other words, it was not the case to say that oxygen and oxides were components of metals, which would mean simple replacement of phlogiston by oxygen.

It would seem a mistake to think that with the abandonment of the phlogiston theory, we get rid of a burden metaphysics in chemistry. Naturally, given the implementation of the new program Laovisier is convenient to say that the concept of phlogiston represented nothing ‘empirically’, but he had, in his time, a scientific meaning, as was contained in a theory which, by the standards of the time was explanatory. Certainly, proponents of the phlogiston theory did not think his central substance as something metaphysical, and in their laboratories, understood that the flames from burning materials were manifestations of the action of a substance that had the property ‘being flammable’ – phlogiston . And if it was possible to criticize the hypothesis that the flames were coming undone because of phlogiston, that ‘no’ is given by the fact that someone had said, “this is not because of the action of phlogiston, but for another reason . ” In fact, there was only a replacement game ontological (or phlogiston or other substance), but a change Explanatory combustion is explained without reference to phlogiston, but with reference to other very different from those described by the theory of phlogiston. But the most important point to be noted is that the whole question of the oxygen and phlogiston is located in the center of a scientific revolution: Lavoisier is proposing a new conceptual framework. In this new scheme presents an equally new chemical nomenclature, it emphasizes the search for explanations that are quantitative in nature etc. There is therefore only a matter of knowing something about phlogiston or oxygen.

THE NATURE OF SCIENCE AND THE DIFFICULTIES OF SCIENTIFIC

It has been said by many that science is a human construct, and there is no reason to deny that consensus. As humans, we tend to want explanations for the phenomena, and as humans, we provide explanations (Psillos, 2002, p.1). For example, we say that the cause of the tsunami is the agitation of tectonic plates. We also say that the cause of falling bodies is gravity and that the cause of combustion is the action of oxygen. The problem is that all these examples are presented by means of linguistic forms inadequate to express what seem to occur in science.13 It is not exactly correct to say that “the cause of falling bodies is gravity.” It would be perhaps more accurate to say that there is a mechanical theory – consists of laws, concepts and principles, including gravity – which explains, among other things, the falling bodies. The acceptance of major scientific theories successful (those that are taught in schools and included in textbooks) occurs mainly for the reason that they explain series of phenomena, and not isolated phenomena. In any case the point is not to correct our form of expression, but rather the realization that, with regard to the scientific explanation, scientific theories occupy a key role. And here is the problem, as would surely be deceived if we were told the story of the chemical revolution as ‘succession’ of the discoveries of Lavoisier (and others) in pursuit of solving certain problems. As we have seen, very early Lavoisier discovers that metals gain weight during combustion. But everything suggests that the explanation of this finding was only part of an immense work that should be done. Lavoisier did not have to just ‘show’ the extra weight, but rather should ‘explain it’. As the explanation is a function not of the experiments, but a theory, it should then build your. And, as a (large) theory is not only the explanation of a phenomenon, others should be explained – which gradually complicates the process as a whole. In plain terms: Lavoisier not only has to explain combustion.

The process is further complicated when we consider other important dynamics of the explanation. In the case of Lavoisier, he not only provided some explanations for the phenomena, but instead, he presented a ‘new way’ of explanation – which, in his case meant building a new chemical. This clearly reveals the emergence of a new form of scientific explanation is a process far more complex than simply show that mercury is heavier after heating. By proposing a new way of explanation, Lavoisier not only need to show the results of warming, but also ‘convince’ his interlocutors that a methodology mathematized is a good way to understand, among other things, the familiar combustion. It follows a certain image of science. We no longer ‘just’ the scientist in his laboratory weighing the lead. We also have the theoretical (you need to build networks explanatory) and rhetoric (which must convince their peers of relevance to weigh the elements). This image of science presents us with the construction of scientific knowledge in such a way that answers ‘yes’ or ‘no’ begin to lose some of its strength, and mainly, this image shows us the difficulties that faced the great scientists and face to propose new ways of dialoguing with reality. We believe that the perception of these difficulties, by teachers, could hardly fail to be considered as a way to understand something about the nature of science.

And the interesting thing is that in presenting such difficulties, the chemistry teacher would be providing an outstanding historical example of how science really works. Of course, this new framework, Lavoisier is not the experimenter that the old rule of chemistry and troublesome metaphysical baggage exemplarily represented by phlogiston. In the new framework Lavoisier doubts, hesitates, waits for the moment he thinks right to disseminate their ideas etc.. Likewise, its adherents are not men who decree that oxygen exists and that phlogiston does not exist. Scientists are before they see the theories of Lavoisier an opportunity to establish a new research agenda for chemistry, this book who expressed the desire for a new form of scientific explanation for chemical processes. In the new plot, phlogiston is no longer a character desirable. But note: this is not to say that phlogiston does not exist.14 What happened was that since Lavoisier, efforts have focused on showing that phlogiston did not exist, but in developing new chemistry proposed by Lavoisier. What is important to disclose that is part of the nature of science to elect certain problems and give up others. Course a thorough historiography ought to evince ‘why’ certain problems are elected. But this leads to discussions beyond the scope of this article, especially considering that the admission of scientific problems has a dynamic that is not only scientific but also social. When Lavoisier’s chemistry takes the scene very quickly disappear references to phlogiston, while not having been declared nonexistent. Thus, it is no longer an issue whether the phlogiston has certain properties, not the fact that phlogiston ‘no more’, but because the scientific questions had changed.

Douglas Allchin produced a case study in a science lesson by using the concept of phlogiston. At the end of this intervention Allchin (1997, p.486) reports that, after students have used the concept of phlogiston, they would lower propensity to consider that past ideas were wrong and the current were self-evident. Interestingly Allchin’s article draws attention to the construction of understanding of a concept that is part of the past history, but without making references to ontological problems. Instead, it proposes an understanding of the concept in its context of production.

Understanding the nature of science is also to understand the dynamics of the production of certain scientific problems, since, in such a dynamic, just by assuming the existence (albeit alleged) of certain entities. But, if they are assumed by virtue of the necessity of theories, then it must be admitted that need.

SCIENCE EDUCATION AND THE NATURE OF SCIENCE

It may be tempting, the scientific educator, joining a pedagogical proposal indicating the importance of the debate realism / antirrealismo to one or more topics of their discipline. But the presentation of this debate without mention of a sophisticated history of the subject can end up distorting the history of the subject, and, of course, to provide an image of science committal to a proper understanding of the nature of science.

In this case, it would be tempting to present Lavoisier as the man who (a) did not believe in the existence of phlogiston and, moreover, (b) showed their absence. We have seen that there are records historiographical who deny (b) and show that (a) seems to be irrelevant. And it would be tempting? Because, presented thus Lavoisier settles our commonsense historiographical; settles to our popular image of science, especially to its progressive nature. Also can make things worse present discussion emphasizing the experiential aspect of research and Lavoisier later contrasted with that aspect of the difficulties in discovering the chemical properties of phlogiston. The picture of contrasts that there would emerge more or less as follows: first we Lavoisier with his theories testable by experiment, on the other had phlogiston theorists who defended theses not amenable to empirical confirmation. This framework is both historically and philosophically indefensible misleading.

From the historical point of view is misleading because (a) can not deduce the impossibility of direct experimentation of an item of chemical (in this case, phlogiston) the conclusion that all the phlogiston theory was not testable empirical; ( b) one can not evade the historical information that, despite the problems with the referentiality of the concept of phlogiston, the tradition of research in chemistry before Lavoisier produced a considerable amount of empirical results, and (c) can not forget that although Lavoisier have in fact proposed a new form of dialogue with nature, many empirical results (eg research on the nature of the air) of the conceptual structure of phlogiston were important for Lavoisier himself. So one thing is registering the problems of referentiality one (though apparently central15 ) concept of a theory, quite another, it is noted that the theory as a whole had problems referentiality. From the philosophical point of view is unacceptable because there is no philosophical theory about science that requires that all concepts of a scientific theory have empirical reference.

Accordingly, tell a story from the perspective of the ‘winner’, although almost unavoidable, definitely always problematic. In the case of the story which we are dealing, the ‘loser’ placed its bets on unobservable phlogiston. What about stories in which the ‘winner’ bet on unobservable natural selection, double-stranded DNA, gravitational force etc..? Is it really the ‘loser’ unobservable lost because its not there, and the ‘winner’ won because their unobservable existed? This is a response to this article has endeavored to show how problematic. Another answer is that the ‘winners’ won not because they were happy to provide the references of all its concepts, but because they built networks that satisfy certain theoretical explanatory scientific demands considered important.16 If this response is accepted, it also emerges a picture of science that could be presented by teachers in their courses.

In the end, perhaps the most presumptuous philosophical solemnly affirm that electrons, leptons and genes do not exist, but it certainly is a philosophical contribution constitute investigate how our beliefs in the existence of these entities and scientific processes as complex. Complexity that is passed on to the moment of his historiographical reconstruction.

Faced with this complexity, how to behave chemistry professor who decide to incorporate into your program for reflection on the nature of science from the realism debate / antirrealismo? A historian devoted a lifetime to clarify one or two episodes scientific, a philosopher devoted a lifetime to structure the debate realism / antirrealismo, as in one or two classes, synthesize what is relevant historiographically an episode and discuss it with historical-philosophical property?

One suggestion would accommodate the episode chosen the traditional framework: show overcoming a theory by another. This suggestion is interesting in that it was not required of teachers a training historiographical greater. Another alternative would be for teachers to present students with the difficulties that great scientists – as Lavoisier – had to overcome in order to enforce their ideas. This overcoming, at least in the specific case of Lavoisier, was not simply the overcoming of the experimenter, but also of theoretical, rhetorical, scientist anyway. When viewing these difficulties, we would be facing a new image of science that point to the inevitable complexity of scientific construction. This is in full agreement with the proposed Matthews (1994 p.5), for whom science is important in the formation of the student’s knowledge also because of their failures. Narrating the failures (or difficulty) of science is, in a way, present it in a more rich and real. Thus, narrating the difficulties in the assimilation of Lavoisier’s oxygen concept is to present an image of science that to some extent reflects what is actually science.

Now, it could be objected that the alternative above is overly simplistic. What kind of historical knowledge the student would get from an exhibition of the difficulties faced by Lavoisier? Surely, it must be admitted, the student would have before him a few historical information. On the other hand, he was faced with what might be called ‘workup historiography’, before a way he can, if you want to understand the history of a scientific subject, enter so qualified the story itself.

Finally, we believe that the second alternative is not ideal. In fact, the ideal would be that science teachers possess a training historiographical and philosophical enough to narrate the story with the authority of the main episodes of his scientific discipline. It would also be the ideal curriculum, reserved space for the history and philosophy of science in the scientific disciplines, but may not be amiss to think in more modest alternatives.

FINAL THOUGHTS

The principle is not possible to know what would have happened if the chemistry the phlogiston theory had not been replaced by the oxygen theory, but history shows replacement and hence the replacement must be understood. One way to understand it is given within the debate on realism / antirrealismo, specifically in the field of ontological debate: a debate between Lavoisier and his rivals was about the ‘existence’ of certain processes and entities. But, as we have seen, the story of this episode can receive another interpretation: the discussion between Lavoisier and his rivals was about the best explanation for certain phenomena.

Now, if what has been plausibly argued, then the adoption of a philosophical attitude about the existence of scientific entities is nothing exclusively by discussions of ontological nature. Of course not denied here that whether an entity exists or not is an important discussion, however, such a discussion can not be located exclusively in the field of ontology. The explanatory dimension must also be taken into consideration.

On the other hand, a wider field, taking into account the explanatory aspect of science is to understand how complex it is and how we should be humble in our attempts to understand it. Science should not be considered fallible only by the fact that new discoveries are made, but because, when it appears, the novelty is not absolute. She is no longer absolute in origin, and not just because other novelty inevitably appear. That is the nature of science.

Bills

1 I will not dwell here on a presentation of fallibilism, generally attributed to the philosopher Karl Popper, in view of the more general aspects of his philosophical position is known to all who are dedicated to the issues of this article. I suggest, however, the classic scientif The logic of discovery (Popper, 1959), for a presentation today used his philosophy.

2 In other words, entities that theories assume to exist. Ontology thus relates to know that theories must assume to exist.

3 This argument is known as the argument of the ‘pessimistic induction’ and was made ​​famous by Laudan (1981).

4 is a controversial issue of naming the ‘unobservable’ entities that are currently part of the scientific heritage, such as gene and electron. In general it is desired to preach if an entity as ‘unobservable’, that such entity does not submit directly to the senses, requiring sophisticated scientific instruments to their perception. A current controversy that exemplifies strikingly the situation is the concept of the gene. However, from the perspective of this article, if you want such controversies ontological not provide adequate understanding of how to use of such entities.

5 This form of presentation of the debate is schematic and serves the purposes of this article. For references about sophisticated forms of presentation of the controversy, see Lipton (1991), Psillos (1999), Boyd (1984) and Van Fraassen (1980).

6 will not be presented here in detail the proposed Matthews.

7 We recognize the limitation of this approach internalist, since science is an activity highly determined by factors external to its own dynamics, such as social factors. However here is a methodological choice made ​​by internalist approach, which should in future be complemented by a more comprehensive approach to understanding the discussion of the nature of science.

8 This section is not intended to provide a story, even synthesized the episode. What it is intended simply leaving the results of some historians, discuss certain philosophical developments possible in certain moments of the revolution in chemistry. Historians mentioned are excellent sources for those who wish to understand the history of the period: Leicester (1971), Partington (1937), Kim (2008) and Thagard (2007).

9 On this point suggest the reading of Quine (1980, p.217).

10 Here we make an overview of reconstructive Thagard (2007), whose article also refers to important historical sources about the episode, which will not be mentioned here. For discussions of the author about other episodes in the history of science, see Thagard (1992).

11 As for Kim (2008), phlogiston became the target of a campaign rhetoric Lavoisier least for problems concerning the stability of the reference to the fact that he did not fit in the new system quantitative chemical that Lavoisier was proposing. According to Kim, phlogiston was not assimilated into the new chemistry of Lavoisier not because it was not real, because for the French chemist phlogiston was as ‘real’ as any other chemical. What happened was that the epistemological shift in the way research chemical was associated with an ontological change. Kim Thagard rejects the conception that there was a dispute between two explanatory theories, for him, not phlogiston provided an explanatory framework, but it was just a body chemistry.However, for the point of this article, it suffices to show the interpretation of Kim as a support of the idea that phlogiston was not abandoned by ontological issues. However, according to Allchin (1997, p.487) the concept of phlogiston in its context and in its scope, was reliable and guaranteed.

12 Not just a theoretical network, but also a form of social support (ie, within the scientific community of which it was part) for their research. The conceptual clarification of this social structure, however, escapes the purposes of this article.

13 One of the philosophers who draws attention to the misuse of scientific expressions is George Berkeley. In his De motu , 1720 (version in Portuguese, Berkeley, 2006), he warned about the inappropriate use of certain expressions. Another philosopher who discusses this point is Thomas Kuhn (1970).

14 On this point it is essential reading Quine (1980). To him, the issues of empirical reference of scientific concepts should be treated from a scan of ‘need’ a concept for a scientific theory. As we have seen, phlogiston was not needed in the new chemistry.

15 On the question whether or not phlogiston was a central concept of chemistry before Lavoisier, see Kim (2008).

16 A philosopher who worked with this issue, antirrealista perspective, was the aforementioned George Berkeley (2006). For him, Newton’s mechanics was successful, and this success explained why the scientific concepts used by Newton were established. But the success of Newtonian mechanics does not follow that these concepts represent empirical objects well defined.

Source: Teaching science: realism, antirrealismo and construction of the concept of oxygen

 

Bible Science Debunked


A Brief Introduction To Biblical Cosmology

It is not uncommon for biblical apologists to make the claim that the Bible miraculously revealed advanced scientific principles long before they were discovered by modern science.  If true, this would lend credibility to the notion that the Bible is divinely inspired (or that the Bible authors were incredibly astute).  But can these claims really be substantiated through an objective analysis of the biblical citations that are presented to support this premise?  In order to find out, I searched the Internet for Christian apologetic websites that tout the Bible as a source of revelatory scientific insight and settled on one developed by a Mr. David Pyles entitled, “Scientific Facts in the Bible.”  I chose Mr. Pyles’ website because it contained more citations than most and included claims that routinely appear on other such websites.

Before examining Mr. Pyles’ claims for the Bible’s amazing scientific accuracy, it is helpful to first set the stage by providing an overview of the ancient Hebrew concept of the universe.  According to the Harper’s Bible Dictionary,

“The ancient Hebrews imagined the world as flat and round [disk], covered by the great solid dome of the firmament which was held up by mountain pillars, (Job 26:11; 37:18). The blue color of the sky was attributed to the chaotic waters that the firmament separated from the earth (Gen. 1:7). The earth was thus surrounded by waters above and below (Gen. 1:6,7; cf. Psalms 24:2; 148:4, Deut. 5:8). The firmament was thought to be substantial; it had pillars (Job 26:11) and foundations (2 Sam. 22:8). When the windows of it were opened, rain fell (Gen. 7:11-12; 8:2). The sun, moon, and stars moved across or were fixed in the firmament (Gen. 1:14-19; Ps. 19:4,6). It was also the abode of the birds (Gen. 1:20; Deut. 4:17). Within the earth lay Sheol, the realm of the dead (Num. 16:30-33; Isa. 14:9,15).”

Yes, those Bronze Age science wizards whose creation folktales were collected in the Old Testament really did believe that the earth was covered by a solid dome.  The Hebrew word translated as firmament in Genesis is “raqiya.”  Strong’s Lexicon (searchable at the Blue Letter Bible website) translates the word as “extended surface (solid), expanse, firmament.”  In keeping with the notion of solidity, the dome was thought to be impervious to water, i.e., it separated the waters above it from the waters below, to contain windows that regulated precipitation, to serve as a surface across which the sun, moon, and stars traveled, and to serve as a sub-floor for the mythical reservoirs of snow and hail (Job 38:22).

The concept of a solid dome in the sky is also exemplified by Job 37:18 which describes God as spreading out the heavens and making them “as strong as a cast metal mirror.” (NKJV)   In Isa. 40:22, the heavens are likened to the fabric of a curtain or tent.  And in a footnote to “raqiya,” Strong’s Lexicon states, “…considered by Hebrews as solid and supporting “waters above.”

A depiction of this archaic concept of a dome-covered universe and further discussion on the subject can found here.

Incidentally, the sky is not blue because a make-believe firmament partially transmits the color of “chaotic waters” confined above it.  It is blue because of a phenomenon known as Rayleigh scattering.

Examining the Claims

In consideration of the foregoing, it is difficult to identify anything that might come close to qualifying as cutting-edge science.  Truth be told, the ancient Hebrew concept of the universe is manifestly unscientific and something that any Typical Scientifically-Ignorant Bronze Age Goat Herder (TSIBAGH) might be expected to have dreamed up.  Be that as it may, in what follows, let’s see how Mr. Pyles’ claims stand up to scrutiny.  (It appears Mr. Pyles has used the KJV Bible for most of his biblical citations.  I have done likewise, unless otherwise specified.)

Claim 1.

Genesis 1:1,3 (written 3,450 years ago): “In the beginning God created the Heaven and the earth … And the Spirit of God moved upon the face of the waters.”

Science expresses the universe in five terms: time, space, matter, power and motion. “In the beginning (time) God created (power) the Heaven (space) and the earth (matter) … And the Spirit of God moved (motion) upon the face of the waters.”

My Response:

Genesis gets off to a rather dubious start in the science department because it violates one of the principal tenets of the scientific method, i.e., it invokes supernatural causation.  Science deals exclusively with natural causes and effects.  (See here.) God, a supernatural entity, cannot be invoked as a scientific explanation for the origin of the universe (or anything else for that matter).  Scientific theories dealing with the origin of the universe do not include reference to any creator gods because to do so would render them utterly unscientific.

According to an earlier understanding of  “Big Bang” theory of the origin of the universe (based on general relativity factors), time started when matter/energy originated and was set in motion through space.   The thinking was that the process began with a so-called singularity in which matter/energy was compressed to an incredibly high density (similar to the condition that is thought to exist at the center of black holes).  Now, taking into account additional factors relating to quantum mechanics, it is the consensus of cosmologists that there was no singularity at the start of the Big Bang. This means that time did not necessarily begin with the Big Bang and that the universe could extend back in time with no limit, i.e., it may have existed in one form or another forever.  In other words, and in contradiction to Genesis, there may well not have been a beginning of the universe for anyone or any thing to cause.  The Genesis creation story provides none of this insight and consists of nothing that a TSIBAGH could not have dreamed up.  More to the point, it is precisely the type of mythical folktale a TSIBAGH would be expected to dream up.

Although Genesis 1:1-3 makes general statements about what God supposedly did, it provides no information regarding how He did it.  Scientific explanations include information not only about what happened, but also about how (using only naturalistic mechanisms) it happened.  Not only does Genesis get virtually everything wrong, it also leaves out far too many details to qualify as a source of useful scientific information on the origin of the universe.

Arbitrarily assigning scientific meanings to words in ancient documents does not automatically lend any scientific credibility to the stories they tell.  One can play the same word game with a number of ancient creation stories.  Consider the following from a part of a Chinese creation story:

In the beginning (time), the heavens and earth were still one and all was chaos.  The universe was like a big black egg, carrying Pan Gu inside itself.  After 18 thousand years Pan Gu woke from a long sleep.  He felt suffocated, so he took up a broadax and wielded it with all his might (power) to crack open the egg.  The light, clear part of it floated up (motion) and formed the heavens (space), the cold, turbid matter stayed below to form earth (matter).

I have inserted the words “time,” “power,” “motion,” “space,” and “matter” using the same logic (or lack thereof) that Mr. Pyles used in his example above.  Does this lend any scientific credibility to the creation story of Pan Gu?  I don’t think so.  Neither do I think it does so when Mr. Pyles uses the same specious approach with the Bible.

Claim 2.

Genesis 2:1 (after creation): “Thus the heavens and the earth were finished, and all the host of them.”

The Hebrew word used here is the past definite tense for the verb “finished,” indicating an action completed in the past, never again to occur. The creation was “finished” — once and for all. That is what the First Law of Thermodynamics says. It states that neither matter nor energy can be either created or destroyed. There is no “creation” ongoing today. It is “finished” exactly as the Bible states.

My Response:

Many creation myths describe the creation event as a onetime occurrence.  (See here.)  There is nothing unique about the Bible in this regard.  Since the ancient Hebrews did not observe any further acts of creation in the heavens or on earth, it would be only natural for them to conclude that God was finished with the process.

Not only does the Bible fail to specifically address the concepts of matter and energy, it neglects to mention one of the most fundamental aspects of the relationship between them, i.e., that they are inter-convertible.  Now if the Bible had included the fact that E=mc2 (something that science did not discover until the Twentieth Century), Mr. Pyles would have something to write home about.  That would have been a revelation that would have given serious credence to the claim that the Bible was divinely inspired.  As it is, again we are left with nothing that a TSIBAGH could not have dreamed up.

Gen. 2:1 implies that God created a specific number of stars, that the creation process is completed, and that the number of stars will remained fixed forever.  While the amount of matter and energy in the universe is constant, there is still a great deal of “creation” occurring at present.   For example, new stars and star systems are forming naturally on a regular basis.  (See here for more information.)

Claim 3.

Genesis 3:15: “And I will put enmity between you and the woman, and between your seed and her seed; it shall bruise your head, and you shall bruise his heel.”

This verse reveals that a female possesses the “seed of life.” This was not the common knowledge until a few centuries ago. It was widely believed that the male only possessed the “seed of life” and that the woman was nothing more than a glorified incubator.

My Response:

The Hebrew word in this passage translated as seed is “zera.”  A common usage of this word in the Bible is to denote “offspring, descendants, posterity, children.”   Consider, for example, Gen. 9:9 – “And I, behold, I establish my covenant with you, and with your seed after you;”

The word “zera” in Gen. 3:15 is translated as “offspring” in the Living Bible and the NLT, NIV, ESV, and HNV Bibles.  The verse makes little sense if it is interpreted as meaning there will be enmity between a sperm and an ovum.  Again there is nothing in this divine threat that a TSIBAGH could not have dreamed up.  It is simply the story of a vengeful god who supposedly punished Adam and Eve by causing dissention among their descendants.

Claim 4.

Genesis 17:12: “And he that is eight days old shall be circumcised among you, every man child in your generations, he that is born in the house, or bought with money of any stranger, which is not of thy seed.”

Why was circumcision to be carried out on the eighth day? Medical science has discovered that the eighth day is the only day in the entire life of the newborn that the blood clotting element prothrombin is above 100%.

My Response:

Which is more likely?  That God magically transmitted the message that baby boys should not be circumcised before eight days.  Or, that it was learned the hard way that whacking off the ends of the penises of boys younger than eight days causes them to bleed to death.  Again there is nothing here that a TSIBAGH could not have discovered by trial and error.  Nonetheless, it is sobering to contemplate how many babies they must have had to kill before the eight-day time limit finally dawned on them, assuming the claim is true?

Furthermore, assuming the claim is true, what about the fact that the blood-clotting systems in different newborns would be expected to mature at different rates?  What about those newborns whose clotting factors had not reached the proper concentrations by day eight?  Presumably they were just another accepted casualty of the penis trimming business.

More to the point, I can find no support for this eight-day optimal prothrombin level in the medical literature.  This claim only appears on some apologetic websites and appears to originate from an apologetic book written by one apologetic doctor.  According to a reliable medical source (See here.), “The newborn coagulation system matures to adult concentrations and functions over 6 months…” and “prothrombin levels lag behind adult concentrations by 20% into childhood…”  If prothrombin concentration is such a big deal, why not wait until these babies had reached adulthood at which time the clotting system would be fully mature and they would have the added benefit of deciding for themselves whether they wanted their penis carved or not?

Claim 5.

Leviticus 17:11 (written 3000 years ago): “For the life of the flesh is in the blood.”

The Scriptures declare that blood is the source of life. Up until 120 years ago, sick people were “bled”, and many died because of the practice. We now know that blood is the source of life. If you lose your blood, you will lose your life.

My Response:

Even a TSIBAGH, after observing numerous animals die as a consequence of losing substantial amounts of blood, should have been able to make the obvious connection that blood is somehow related to the maintenance of life.  The animal is wounded, the blood drains out, and the animal dies. Therefore, blood is somehow involved in keeping animals alive.  Again, there is nothing indicative of supernaturally transmitted wisdom here.

Just for the record, blood is not the sole “source” of life.  Blood is just one of a number of body fluids that are essential for life.  Others include: lymphatic fluid, cerebrospinal fluid, synovial fluid, and urine. They are all necessary for survival.

If the Bible authors were such hotshot anatomists, why didn’t they have a clue about the function of the brain?  They always associated thought processes and emotions with the heart (See here.) and the kidneys (See here.), and never associated any metal processes with the brain.  There is not a single instance in the Bible where it talks about the heart pumping blood or having anything to do with blood.  Nor is there any mention of the brain being the seat of consciousness or thought.  In fact, the Bible never mentions the brain at all.  Why would a God who supposedly gave them the lowdown on the “source of life” keep them in the dark about the true functions of such vital organs as the heart and brain?  Sounds suspiciously like these stories were written by a bunch of TSIBAGH’s to me.

Claim 6.

Leviticus 15:13 (written 3000 years ago): “And when he that has an issue is cleansed of his issue; then he shall number to himself seven days for his cleansing, and wash his clothes, and bathe his flesh in running water, and shall be clean.”

The Bible said that when dealing with disease, hands should be washed under running water. Up until 100 years ago doctors washed their hands in a basin of still water, resulting in the death of multitudes. We now know that doctors must wash their hands under running water. The Encyclopedia Britannica documents that in 1845, a young doctor in Vienna named Dr. Ignaz Semmelweis was horrified at the terrible death rate of women who were dying after giving birth in hospitals. As many as 30% of those giving birth died. The Doctor noted that doctors would examine the bodies of those who had died, then, without washing their hands, go straight to the next wards and examine expectant mothers. This was their normal practice, because the presence of microscopic diseases was unknown. Doctor Semmelweis insisted that doctors wash their hands before examinations, and the death rate immediately dropped down to 2%.

My Response:

If God was so all-fired concerned about people’s health 3000 years ago, why didn’t he inform them that many diseases are caused by very small living organisms that can spread from one individual to another?  That way they could have avoided direct contact with infected individuals.  Why didn’t he instruct them how to make soap for cleansing (or better yet, antibiotics), which would have greatly reduced the spread of infectious diseases?  It is generally agreed that the disease under discussion in Lev. 15:13 is leprosy.  Why would God give them false information and tell people they would be free of the disease if they simply washed their clothes and took a bath?

Does the Bible really teach sound hygienic and disease prevention principles?  Consider the Bible’s foolproof method for eliminating leprosy from a dwelling. (See Lev. 14:36-54)

To summarize the process, it involves a priest entering the house in which an infected individual had lived.  If he sees red and green stripes/spots on the walls under the surface, he closes the house and returns after seven days.  If, when he returns, he sees the spots have spread, he orders removal of the affected parts of the wall.  After that, he orders all the walls to be thoroughly scraped and the removed section to be replaced.

But, if after this procedure, the spots appear and spread again, the priest concludes that the infected person had leprosy and the house is “defiled.”  In this case he orders it to be destroyed. However, if the spots have not reappeared, the priest declares the house clean and the leprosy to have been eliminated.  And now the fun begins.

If the house is pronounced clean, he next performs a cleansing ceremony which involves the use of two birds, cedar wood, scarlet thread, and hyssop branches.  He kills one of the birds over a bowl of water.  Then he dips the living bird, the cedar wood, the hyssop branch, and the scarlet thread into the bloody water from the killed bird.  Then he sprinkles this concoction on the walls of the house seven times, and poof, the house gets the Good Housekeeping Seal of Approval.  But wait, there’s more.  He then releases the living bird into the boondocks as a gesture of atonement.

(I am not making this up, read it for yourself.)

Does this suggest that the biblical authors had a firm understanding of the causes of diseases like leprosy and the proper procedures for eradicating it?  Does this treatment regimen suggest that God was channeling divine wisdom of the medical sciences to them?  Again, it sounds like the ramblings of a TSIBAGH to me.

Things had not measurably improved by New Testament times.  Jesus is said to have cured one blind man by spitting on the ground, making a mud pie, and smearing the mud on the man’s eyes.  (See John 9:1-15)  Another blind man was claimed to have been cured when Jesus spit directly into his eyes. (See Mark 8:23-35)  These stories about magic spittle have all the hallmarks of having been dreamed up by a typical 1st century witchdoctor.  According to Jas. 5:14-15, people who are sick should just ask church elders to slather them with oil and pray.  I wonder, if someone in Mr. Pyles’ family contracted a serious illness, would he look to the Bible for medical advice or would he consult a certified physician?

Claim 7.

Job 26:7 (written 3500 years ago): “He stretches out the north over the empty place, and hangs the earth upon nothing.”

Less than 200 years ago, through the advent of massive telescopes, science learned about the great empty space in the north. Also the Bible claimed that the earth freely floated in space, but science then thought that the earth sat on a large animal. We now know that the earth has a free float in space.

(The first scientist having this understanding would appear to be Copernicus around 1500. Examples of Scientific Accuracy in the Bible By David Pyles)

My Response:

The laughable view of the earth sitting on a large animal is a product of pagan religious mythology, not science.  You can't blame that 
kind of thinking on scientists because there were no formally-trained scientists around 3500 years ago who thought such a thing.  
Although the ancient Greeks had a quasi-scientific approach to reality, true science (the method of learning based on observation,
hypotheses, experimentation, and more observation) did not reach full development until the Renaissance period (the 14th - 17th 
Centuries).  No true scientist, who practices the scientific method, has ever claimed that the earth is sitting on anything.

The word "north" in this passage is used synonymously with "firmament."  (See here.)  What this passage is describing is the stretching
of the dome-shaped firmament over the earth with no supports in the middle.  To the ancient Hebrews, the earth was unattached to the
center of the dome (i.e., the earth hung on nothing) just like the floor of a building is unattached to the center of a dome that covers it.

It is no secret that the Bible often contradicts itself.  In this case, the notion that the earth hangs on nothing is contradicted by other verses.  For example, 1 Chron. 16:30 “…the world also shall be stable, that it be not moved.”  Psa. 93:1 “…the world also is stablished, that it cannot be moved.” Psa. 96:10 “…the world also shall be established that it shall not be moved:”  Psa. 104:5 “[Who] laid the foundations of the earth, [that] it should not be removed for ever.”  Job. 26:11 “The pillars of heaven tremble…”  2 Sam. 22:8 “…the foundations of heaven moved…”  Rather than hanging on nothing, these verses depict the earth and heavens as being firmly fixed on some kind of solid foundation or pillars.

Of course, we now know the author of Job was wrong when he said the earth hangs on nothing.  It "hangs" on the gravitational fields 
of the sun, moon, and other planets in its vicinity.  It is, of course, this attraction that keeps the earth in orbit around the sun.  Not only did 
the author of Job not know that the earth revolved around the sun (or rotated on its axis for that matter), he did not know anything about 
gravitation fields because they are invisible and God apparently neglected to tell him about them.  He surmised the earth hung on nothing 
because, when he looked at the "dome of heaven" there appeared to be nothing that attached the earth to it.  Again, his observations were
consistent with what a TSIBAGH would be expected to have dreamed up.

Claim 8.
 Job 28:25 To establish a weight for the wind, And apportion the waters by measure. 

The fact that air has weight was proven scientifically only about 300 years ago. The relative weights of air and water are needed for the efficient functioning of the world’s hydrologic cycle, which in turn sustains life on the earth.

My Response:

Job is largely a book of poetry.  It is reasonable, therefore, to assume the author was using “weight” in a poetic sense in this passage to indicate that the wind had a force associated with it.  In fact, the NIV, HNL, and World English Bibles do just that and translate the verse as: “…he established the force of the wind…” The NLT and Living Bible versions translate it as: “He made the winds blow…”

There is nothing in this passage to indicate the author had the foggiest idea that air was composed of a mixture of gasses that
have mass.  The passage is describing the air in motion, i.e., wind, which does feel as if it has a weight to it.  Any TSIBAGH who felt the 
force of a violent wind such as a sandstorm would consider it to have a definite heft or weight behind it.  No divine scientific insight
is evident here. 

Claim 9.

Job 38:12, 14, (written 3500 years ago) God Himself says: “Have you commanded the morning since your days; and caused the dayspring to know his place; that it might take hold of the ends of the earth, that the wicked might be shaken out of it? It [the earth] is turned as clay to the seal; and they stand as a garment.”

Modern science has come to understand that the earth’s rotation on its axis is responsible for the sun’s rising and setting. The picture here is of a vessel of clay being turned or rotated upon the potter’s wheel — an accurate analogy of the earth’s rotation.

My response:

As is so often the case, this argument is based on a questionable translation of the verses in question.  Rather than having anything to 
do with rotation, Job 38:14 is best translated as referring to the visual transformation the earth undergoes as the sun rises.  The ESV Bible 
translates the passage as: "It is changed like clay under a seal and its features stand out like a garment."  The words "changed" and 
"changes" are also used in translating this passage in the NASB, RSV, ASV, HNV, and DBV Bibles.  The NIV Bible translates it as: 
"The earth takes shape like clay under a seal; its features stand out like those of a garment." 

This passage is not talking about rotation.  It is describing the fact that the earth's features begin to reveal themselves (like a seal in 
clay or features in a garment) as the morning sun begins to shed light on them.  Again, nothing that a TSIBAGH poet could not have 
dreamed up.  And what about this nonsense having to do with grabbing the earth by its "ends" and shaking people out of it?  How does 
that comport with the modern scientific understanding of a spherical earth?

Claim 10.

Job 38:16 speaks of springs in the sea. It is now known that there are indeed such springs on the ocean floor.

The earliest literature indicating an understanding of hydrological cycle was apparently around the third or fourth century BC. However, the essential details of this cycle were all revealed in the Bible well before this time. This may be seen from the following texts:

The wind goeth toward the south, and turneth about unto the north; it whirleth about continually, and the wind returneth again according to his circuits. All the rivers run into the sea; yet the sea is not full; unto the place from whence the rivers come, thither they return again. – Eccl 1:6,7

For he maketh small the drops of water: they pour down rain according to the vapour thereof: which the clouds do drop and distil upon man abundantly. – Job 36:27,28

It is he that buildeth his stories in the heaven, and hath founded his troop in the earth; he that calleth for the waters of the sea, and poureth them out upon the face of the earth: The LORD is his name. – Amos 9:6 (Examples of Scientific Accuracy in the Bible By David Pyles)

My Response:

Job 38:16 –   From this site:

“Freshwater submarine springs occur all over the world – from New York to California, from Bahrain to Barbados.  Water pushing to the surface of the sea shows the boil of the spring and can be spotted easily when the tides are low.”

As the article states, these springs arise when fresh water is transported in rocky conduits out into the ocean.  No divine wisdom necessary here – just the ordinary observational skills of a typical scientifically-ignorant Bronze Age sea captain.

Eccl. 1:6  –  The Hebrew word translated as “circuits” in Eccl. 1:6 is “cabiyb.”  It is translated in the AV Bible 252 times as “round about,” 26 times as “on every side,” and 24 times as “about.”  Eccl. 1:6 is the only time in the Bible it is translated as “circuits.”  Rather than specifying any miraculous knowledge of high atmospheric jet streams, this passage, if the common translation is used, more accurately describes winds that simply blow around or about.

Some Bibles do provide a translation that is in keeping with the standard meaning of the word.  For example, the NLT Bible and the Living Bible translate the passage as: “The wind blows south and north, here and there, twisting back and forth, getting nowhere.”

Again, nothing here that a TSIBAGH would not be aware of.

Eccl. 1:7  –  Well duh!  Since the rivers run into the sea and the sea never fills up, even your TSIBAGH might guess that somehow the water gets back from the sea to the rivers.  Of course no indication is given by this author how this transference might occur.  Now if he had informed his readers that water evaporates from the ocean and forms clouds, and that those clouds are blown over the land where they eventually are cooled to produce rain by condensation, he might have revealed some sort of unique knowledge of the hydrologic cycle.  As it is, no divine insight is evident in this passage.

Job 36:27-28  –  All these verses infer is that the author thinks God makes the rain drops which fall on people from the clouds.  The word translated as “distil” in verse 28 is “ra’aph” which means to “drop down.”   There is nothing in these verses specifying evaporative processes which produce the clouds from which the rain falls.  In other words, nothing that a TSIBAGH would not be expected to dream up.

Amos 9:6  –  This is the description of a supernatural being who builds his palace above the firmament and places its foundations on the earth and speaks to the water causing it to move through mysterious channels from the seas to the sources of the rivers and streams from whence it pours out onto the land.  There is nothing of scientific merit here.  Just the pious and farfetched ramblings of a TSIBAGH .

To gain a better understanding of how the ancient Hebrews understood these texts, it is helpful to look at that the targum of Ecclesiastes.  (A targum is an Aramaic translation of the Hebrew Bible which better represents how the verses would have been understood at the time they were written.)  The targum of Eccl. 1:7 (Grossfeld translation) reads as follows:

“And the sun rises in the day from east, and goes down in the west by night, and hastens to its place, and goes down through the path under the sea, and rises the following day from the place where it rested yesterday; it goes all the side of the south in the day, and goes round to the side of the north by night, through the path under the sea; it turns round and round to the wind of the south corner in the revolution of Nisan and Tamuz, and returns its circuits to the wind of the north corner in the revolution of Tishri and Tebeth; it comes through the windows of the east in the morning, and goes into the windows of the west in the evening. All the rivers and streams of water go and flow into the waters of the ocean which surround the world like a ring, and the ocean is not full, and to the place where the streams go and flow there they go again through the channels of the sea.”

In this description, we see that the ancient Hebrews thought that there were some kind of channels in the oceans that transported the water back to the sources from which it came.  There is no indication in this verse that evaporation or cloud formation had anything to do with it.  Note also the belief that the sun completes its daily circuit by passing under the sea at night.

Claim 11.

Job 38:19 (written 3500 years ago). “Where is the way where light dwells?”

Modern man has only just discovered that light (electromagnetic radiation) has a “way,” involving motion traveling at 186,000 miles per second.

My Response:

Not surprisingly Mr. Pyles left off the second half of this verse which reads, “…and darkness, where is the place thereof.”  This passage is not dealing with the motion of light.  It is dealing with the question the ancient Hebrews asked regarding where light and darkness reside.  They thought that light and darkness were two independent entities that “dwell” in different locations.  This interpretation is further supported by the next verse, Job 38:20, which reads, “That thou shouldest take it to the bound thereof, and that thou shouldest know the paths [to] the house thereof?

Alternative translations of Job 38:19 are provided by the NLT Bible (“Where does the light come from, and where does the darkness go?”) and the NIV Bible (“What is the way to the abode of light? And where does darkness reside?”)  In other words, the TSIBAGH who wrote this stuff didn’t have a clue about the true nature of light and darkness – let alone that light is electromagnetic radiation that travels 186,000 miles a second.  He was asking, where is the path that leads to the light’s dwelling place.

Claim 12.

Job 38:22 (written 3,500 years ago). God says: “Have you entered into the treasures of the snow?”

It wasn’t until the advent of the microscope that man discovered that each and every single snowflake is uniquely a symmetrical “treasure.”

My Response:

Talk about playing word games!  The Hebrew word translated as “treasures” in this passage is “owstar.”  According to Strong’s Lexicon, the word is used 79 times in the Bible: (treasure(s) 61, treasury 10, storehouse(s) 3, cellars 2, armoury 1, garners 1, store 1).  “Owstar” derives from the root word meaning to store up, save, and lay up.  In speaking of these “treasures,” Job 38:23 reads, “Which I have reserved against the time of trouble, against the day of battle and war?”  Cleary the intent of these passages is to depict a storage place for frozen forms of water. There is no rational basis for inferring that this word is describing the intricate shapes of snowflakes.  It refers to the mythical storehouses of the snow which the TSIBAGH thought existed above the equally mythical firmament.  Accordingly, most Bible versions translate this phrase as “storehouses” or “treasuries” of the snow.

Furthermore, and not surprisingly, Mr. Pyles left off the second half of Job 38:22.  I reads, “or hast thou seen the treasures of the hail,” What is so remarkable about hail that it would be called a “treasure” in the same sense as a snowflake?

Claim 13.

Job 38:35 (written 3,500 years ago. God Himself speaking): “Can you send lightnings, that they may go and say unto you, Here we are?”

The Bible here is saying a scientifically ludicrous statement — that light can be sent, and then manifest itself in speech. But did you know that radio waves move at the speed of light? This is why you can have instantaneous wireless communication with someone on the other side of the earth. Science didn’ t discover this until 1864 when “the British scientist James Clerk Maxwell suggested that electricity and light waves were two forms of the same thing” (Modern Century Illustrated Encyclopedia, Vol. 12).

My Response:

Finally a point of agreement: “The Bible is saying a scientifically ludicrous statement.”  This passage is referring to average run-of-the-mill lightning (the Hebrew word “baraq”) not electromagnetically coded messages.  The ancient Hebrews thought that God could hurl lightning bolts at will and that they “spoke” back with thunder. (See 2 Sam. 22:15; Psa. 18:14, 77:18, 135:7, 144:6; Jer. 10:13; and Zec. 9:14)  That is all this passage is conveying; nothing that a TSIBAGH could not concoct.

Claim 14. 

Psalm 8:8: “And the fish of the sea, and whatsoever passes through the paths of the seas.”

What does the Bible mean by “paths” of the seas? The sea is just a huge mass of water, how then could it have “paths?” Man discovered the existence of ocean currents in the 1850’s, but the Bible declared the science of oceanography 2,800 years ago. Matthew Maury (1806- 1873) is considered to be the father of oceanography. He was bedridden during a serious illness and asked his son to read a portion of the Bible to him. While listening, he noticed the expression “paths of the sea.” Upon his recovery, Maury took God at His word and went looking for these paths. His book on oceanography is still considered a basic text on the subject and is still used in universities.

My Response:

There is nothing in this verse to indicate it is speaking specifically about continent-spanning ocean currents.  (In fact the TSIBAGH didn’t know most of the earth’s continents even existed.)  There is no reason to think it is speaking of anything other than the routes that animals and humans take as they traverse the waterways in the Mediterranean area, where biblical authors lived.  Ancient seafarers were aware that routes had to be chosen carefully to avoid dangerous shoals, local currents, rock outcroppings, etc.  Hence it would not be unexpected that they might speak of paths in the sea.

Any experience the Old Testament authors would have had about sea travel would have been confined primarily to the Mediterranean Sea area.  There is a current in the Mediterranean Sea that is caused by the outflow of warm saline deep water across Gibraltar, which is compensated by an inflow of a less saline surface current of cold Atlantic oceanic water.  If this verse is actually referring to currents, there is no reason to assume it is referring to anything other than this current in the Mediterranean Sea.  However, it would not take divine inspiration discover such a current.  A few boat trips in the affected area would soon make it evident.

Regardless where Matthew Maury got his inspiration, he was not the first to recognize the significance of ocean currents.  As we are informed at this site,

“Mariners have known for many centuries that the ocean contains currents that flow along generally consistent paths. The Spanish galleons transporting gold and silver from Mexico to Spain made use of the Gulf Stream to help them return home, while Benjamin Franklin used ships’ log books to draw a map of this current in 1772.”

If Maury had studied Franklin’s writings, instead of relying on the Bible, he would have learned about “paths in the seas” considerably sooner than he did.  No divine insight from a holy book was necessary to discover what Franklin and early seamen had already discovered through normal observational skills.

Claim 15.

Psalm 19:4-6: “In them has He set a tabernacle for the sun, which is as a bridegroom coming out of his chamber, and rejoices as a strong man to run a race. His [the sun's] going forth is from the end of the heaven, and his circuit unto the ends of it: and there is nothing hid from the heat thereof.”

Bible critics have scoffed at these verses, saying that they teach that the sun revolves around the earth. Science told them that the sun was stationary. Then they discovered that the sun is in fact moving through space at approximately 600,000 miles per hour. It is traveling through the heavens and has a “circuit” just as the Bible says. It is estimated that its circuit is so large, it would take 200 million years to complete one orbit.

My Response:

Which is more likely?  The ancient Hebrews knew that the solar system is located in an immense galaxy and that everything in the galaxy revolves around the galactic center.  Or, is it more reasonable to assume the ancient Hebrews believed that the sun rose in the morning, moved across the firmament during the day, and set in the evening, and that it completed this “circuit” once every day.  Isn’t it more reasonable to assume that they were simply describing what appeared to them to be a sun that rises, moves across the half-dome of the sky, and then returns (makes a circuit) to its starting point by the next morning?  Based on their rudimentary understanding of a dome-shaped (tent-draped) structure of the universe and the notion that the sun traveled under the water at night returning to its starting point, it is entirely reasonable to argue that it does.  (See also my response to Claim 10 regarding the targum of Ecclesiastes.)

The sun does not travel across a stationary “heaven” as the verse implies.  The sun and all other objects in the galaxy revolve together around the center of the galaxy.  The sun is moving in unison with the other sun systems in galactic space.  If anything, the sun and the so-called “heavens” move as a continuous unit.  Be that as it may, these verses are not talking about the sun rotating around the galactic plane once every 200 million years.  They are, when considered in context, talking about the sun rising and setting and returning to its starting place, i.e., making its circuit, on a daily basis.

If it is argued these verses imply knowledge of the fact that that the sun revolves around the galactic center, then it follows that the Bible should also teach that the earth is moving in unison with it.  But that is not what the Bible teaches.  Various scriptures teach that the earth is fixed and immovable.  (See, for example, 1 Chron. 16:30, Psa. 93:1, 96:10, and 104:5 in my response to Claim 7.)  There is a clear distinction in the Bible between a moving sun and an immovable earth.   A fixed immovable earth is seriously at odds with any suggestion that Psalm 19:4-6 is describing the movement of the sun around the galaxy since the sun and earth move together in that respect.

Bible critics are not the only ones who maintain that this verse teaches that the sun revolves around a stationary the earth.  Bible thumpers who believe the sun actually does revolve around the earth also hold that position.  For example, this site lists 67 Bible verses that “tell us it is the sun and not the earth that moves.”  Three of the verses they cite are Psalm 19:4-6. Too bad God, in his infinite wisdom, did not see fit to inspire the authors of the Bible to express themselves in a coherent manner that did not lead to so much confusion. Even the gung ho Bible believers have trouble agreeing on what it says.

Claim 16.

Ecclesiastes 1:6 The wind goes toward the south, And turns around to the north; The wind whirls about continually, And comes again on its circuit.

The Bible describes the circulation of the atmosphere.

The Bible includes some principles of fluid dynamics.

My Response:

Mr. Pyles’ creative exegesis notwithstanding, the major wind systems on earth do not blow latitudinally north and south in circuits around the earth.  Although the jet streams have north and south components in each hemisphere, they do not blow around the earth in a north/south direction.  The overall circulation is longitudinally from the west to the east (in a circuit around the earth) driving the earth’s weather systems along with them.   A more sensible reading of this verse would be that sometimes the wind blows north in a localized area and sometimes it reverses direction (in that same area) and blows south, i.e., it appears to blow in circles.

See also my response to this verse under Claim 10.

If this verse shows the Bible includes some principles of fluid dynamics, then the “The Little Engine that Could” is a scientific masterpiece on thermodynamics.

Claim 17.

Jonah 2:6 (written 2,800 years ago): “I went down to the bottoms of the mountains; the earth with her bars was about me for ever: yet have you brought up my life from corruption, O LORD my God.”

When Jonah was in the depths of the ocean, he spoke of going down to the “bottoms of the mountains.” Only in recent years has man discovered that there are mountains on the ocean floor. The greatest ocean depth has been sounded in the Challenger Deep of the Mariana’s Trench, a distance of 35,798 feet below sea level. Mount Everest is 29,035 feet high.

(Genesis 10:25 speaks of one Peleg whose name means division. The text then explains that he was so named because in his days the earth was divided. It is now commonly believed that all continents of the earth were once combined into a single continent called Pangaea. This belief is based upon the fact that present continents appear somewhat as pieces out of a puzzle. There are also other evidences, including several geological similarities on matching continental edges. {Examples of Scientific Accuracy in the Bible By David Pyles})

My Response:

Jonah 2:6  –  Are we really supposed to believe that a story about a man who supposedly survived three days under the ocean in the belly of a whale is a reliable source of scientific information?  Apparently Mr. Pyles thinks so.  But what about the lack of oxygen and the corrosive effects of the whale’s digestive juices?  Why, it would require a miracle to survive such an ordeal.  However, if Mr. Pyles uses a miracle to explain it, he is no longer talking science because miraculous explanations are verboten in science.

This verse speaks of Jonah descending to the roots/foundations of mountains that are visible from the surface.  There is nothing in this verse that suggests it is referring to submarine mountain ranges.  It would have been obvious to any TSIBAGH that mountains extend down into the water to depths often further than they could see.  It would also not have been beyond their comprehension that the mountains must be attached to a bottom somewhere and that, if they went deep enough, they could see them.  Furthermore, Jonah’s far-fetched journey to the “bottoms of the mountains” is consistent with the Bible’s erroneous view that the earth rested on some kind of foundations.  No divine insight was necessary in composing this verse.

Gen. 10:25  –  Firstly, this verse could not be accurately referring to continental drift because the continents in one form or another have been moving continuously for billions of years, not just during the limited time span of one man’s life.

Secondly, there is considerable disagreement among Bible scholars about what this verse actually means.  Some think the division refers to land, some think it refers to language, and some think it refers to people.  For example, the NLT Bible translates the verse as:

“Eber had two sons. The first was named Peleg–“division”–for during his lifetime the people of the world were divided into different language groups and dispersed. His brother’s name was Joktan.”

One of the more thorough analyses of the verse (See here) concludes the following:

“Strong linguistic and scientific arguments oppose the two interpretations of

Genesis 10:25 commonly taught: (1) a division of people by multiplication of languages,

and (2) the beginning of continental drift. Instead, these studies point to an earth being

divided by rising water in the days of Peleg.”

Mr. Pyles’ attempted correlation of this verse with continental drift does not survive rigorous linguistic and contextual analysis.  He does, nonetheless, spin a whale of a tale.

It is amusing how Mr. Pyles habitually selects a rather mundane biblical verse, warps it out of context, and then attempts to equate it with some significant modern-day scientific achievement.  Equating Jonah 2:6 with the discovery of oceanic trenches that are tens of thousands of feet deep and Gen. 10:25 with the discovery of continental drift are cases in point.

Claim 18.

Amos 9:6 (written 2,800 years ago): “He … calls for the waters of the sea, and pours them out upon the face of the earth; the Lord is His name.”

The Mississippi River dumps over six million gallons of water per second into the Gulf of Mexico. Where does all that water go? That’s just one of thousands of rivers. The answer lies in the hydrologic cycle, something that was not fully accepted until the sixteenth and seventeenth centuries, 2500 years after the Bible said that God takes the waters of the sea, and pours them upon the face of the earth.

My Response:

See my previous discussion of this verse under Claim 10.

Claim 19.

Jeremiah 33:22 (written 2500 years ago): “As the host of heaven cannot be numbered, neither the sand of the sea measured.”

The Bible claimed that there are billions of stars (“host of heaven” is the biblical term for the stars). When it made this statement, no one knew how vast the numbers of stars were as only about 1,100 were observable. Now we know that there are billions of stars, and that they cannot be numbered.

(The Bible asserts that the stars are innumerable (Gen 15:5, Gen 17:7, Heb 11:12). This does not necessarily mean that we are incapable of mathematically expressing their number. It means that no human has the ability to count them individually so as to achieve their sum. It is claimed that there are 100 billion stars in our galaxy alone. If stars were counted around the clock at one star per second, then it would take over 3000 years just to count these. Add to this the fact that there are as many as 100 billion galaxies. However, there were many scholars prior to Galileo who believed that the stars could be counted, and several attempts were made to do so. Many of these counts arrived at around 1000 stars. Examples of Scientific Accuracy in the Bible By David Pyles).

My Response:

Jer. 33:22 does not say there are many hundreds of billions of stars.  It just says that there are too many for a TSIBAGH to accurately count. No scientific breakthrough is evident here.

My wife and I once camped at Alturas Lake (elevation 7,000 feet) in the Sawtooth National Recreation Area.  One moonless night I stepped out of the camper and was greeted with one of the most amazing sights I have ever had the privilege of viewing.  Glancing skyward, I was confronted with a sky so completely filled with stars of all intensities (from incredibly bright to barely visible) that it literally took my breath away.  I called my wife and we both stood there awestruck by the incredible number of stars that filled the night sky.  After that experience, it is obvious to me that no one could ever hope to accurately count the number of stars in the sky. And it doesn’t take divine intervention to come to that conclusion.

The Bible elsewhere says that the stars are not too numerous to be counted.  Psalm 147:4 says that God has counted them all and even calls each one by name.  (I wonder what He does in His spare time?)  In Gen. 22:17, God promises Abraham that his descendants will be as numerous as the stars in heavens.  As Mr. Pyles correctly states, there are an estimated 100 billion galaxies, each containing some 100 billion stars. (The actual estimate is around 1,000,000,000,000,000,000,000 stars in the universe.) It is estimated that, since the existence of humans, approx. 110 billion people have lived on earth. (See here.)  Since only a relatively small fraction of these people would have been (would be) the direct descendants of Abraham (if such a person ever actually existed), it is highly unlikely that his offspring will ever approach anything near the number of stars in the universe.

Claim 20.

Isaiah 40:12 (written 2,800 years ago): “Who has measured the waters in the hollow of His hand …”

We are told that God has measured the waters and set a proper amount of water on the earth. Modern science has proved that the quantity of water on earth is just enough for our needs. If the sea became three meters deeper, the water would absorb all the carbon dioxide and nitrogen, and no creature could live any longer.

My Response:

Woops!  Pardon me while I readjust my B.S. meter.  It just pegged off scale.

Since I was unable to find any scientific support for this claim, I consulted some of my knowledgeable friends at the Freethough and Rationalism Discussion Board on the Internet.  A couple of them did some calculations that explain why my B.S. meter reacted as it did.  The calculations are as follows:

“The world’s oceans (not including land locked seas) have a mean surface area of 139,000,000 square miles. They contain an approximate volume of 310,000,000 cubic miles of water. 3 meters = 0.0018641135767 miles. The volume gained by pouring an additional 3 meters worth of water on the top can be approximated by multiplying 139,000,000 square miles by 0.0018641135767 miles, giving 259,112 cubic miles. To see the effect of adding that much water, compare the 310,000,000 cubic miles with 310,259,112 cubic miles. It amounts to changing the volume of the oceans by about 0.08%. Additional absorption of gases into this slightly larger body of water would not be substantially different from that 0.08%. Certainly these numbers are only approximately correct, but they seem adequate to discount the particular claim made.” (Adapted from calculations contributed by “Cobalt.”)

“Ignoring the fact that the oceans would cover more surface area if their levels rose, the total surface area of the oceans is 3.6×1011 m2. Multiply that by 3 meters deep, and you get 1.1×1012 m3. That translates to 1.1×1015 liters.  Factoring in the solubility of gas in seawater at 20 C of approx 7.2 mg/L (it varies, but let’s just take this as an average), we get that if an additional amount of water were to magically appear, it would absorb another 8×109 kg of air.  According to wikipedia, there are about 5.1×1018 kg of air on Earth. So, were all this de-aerated water to magically appear on Earth, once it was done decimating all of our coastal cities, it would proceed to absorb only about 0.00000001% of the air in our atmosphere.”  (Adapted from calculations contributed by “uberhobo.”)

From these calculations it appears (as I suspected) that an additional three meters of water in the oceans would have only a marginal effect as far as overall gas absorption is concerned.  It is not clear on what basis Mr. Pyles made this dire claim, but it appears it simply may have been concocted out of thin air or copied without any attempt at verification from some other apologetic source.

I wonder if the Bible science gurus who make this claim ever stop to consider how it impacts their much-ballyhooed Noah Flood story. Assuming for the sake of argument that the Flood actually did occur as described in the Bible, the waters in the oceans would have risen many times higher than three meters during the event. If an additional three meters added to the oceans would exterminate all life as we know it by absorbing vital gases, just think what water rising above the highest mountains and covering the entire surface of the earth would do.  (See Gen. 7:19-20)  There is no way Captain Noah, his crew, and his menagerie could have lived through the nearly year-long Flood of those proportions if vital gases are absorbed by water as Mr. Pyles claims they are.  If what Mr. Pyles claims is true, he has effectively refuted the Flood story in the Bible.  (If he claims some kind of miraculous intervention saved the day, he is no longer making a scientific argument.  Miracles are not permitted as scientific explanations.)

Claim 21.

Isaiah 40:22 (written 2800 years ago): “It is he that sits upon the circle of the earth.”

The Bible informs us here that the earth is round. At a time when science believed that the earth was flat, it was the Scriptures that inspired Christopher Columbus to sail around the world. He wrote: “It was the Lord who put it into my mind. I could feel His hand upon me … there is no question the inspiration was from the Holy Spirit because He comforted me with rays of marvelous illumination from the Holy Scriptures …” (From his diary, in reference to his discovery of “the New World”).

(Other statements in the Bible also indicate that God revealed this truth long ago. For example, David said that God has removed our transgression from us as far as the east is from the west (Ps 103:12). On a spherical surface, east and west are infinitely separated in the sense that one can travel indefinitely in either direction without ever attaining the other. However, Solomon described the wind as blowing in circuits, first towards the south and then turning toward the north. North and south are not infinitely separated as east and west, because a southward traveler on a spherical surface will be heading north after crossing the south pole. Examples of Scientific Accuracy in the Bible By David Pyles )

My Response:

Newsflash to Mr. Pyle, “The earth is a sphere, not a flat circle like a Frisby.”

The Hebrew word translated as “circle” in this verse is “chuwg.”  The word is used only three times in the Old Testament and is translated in three different verses as “circle,”  “circuit,” and “compass.”  “Chuwg” does not connote a spherical shape.  In the case of Isa. 40:22, it describes the earth as being a flat disk.  If the author of this verse had wanted to describe the earth as a sphere, he would be expected to have used the word “duwr” which is translated as “ball” in Isa. 22:18.   The Hebrews had a word that would have correctly described the earth as a sphere.  The author of Isaiah didn’t use it in Isa. 40:22, but he did use it in Isa. 22:18 where he was describing a spherical object.  Instead, he used a word that was understood to mean a flat round disk.  The author of Isaiah simply got it wrong.  No divine insight (and certainly no scientific insight) is evident with this verse.

The irony is that people who believed the earth is flat had no trouble finding Bible verses to support their worldview as well.  Consider the following verses:

Isaiah 11:12
” And he shall set up an ensign for the nations, and shall assemble the outcasts of Israel, and gather together the dispersed of Judah from the four corners of the earth.”

Revelation 7:1
“And after these things I saw four angels standing on four corners of the earth.  holding the four winds of the earth, that the wind should not blow on the earth, nor on the sea, nor on any tree.”

(A spherical earth does not have corners. Its surface is continuous.)

Job 38:13
“That it might take hold of the ends of the earth, that the wicked might be shaken out of it?”

Jeremiah 16:19
“O LORD, my strength, and my fortress, and my refuge in the day of affliction, the Gentiles shall come unto thee from the ends of the earth, and shall say, Surely our fathers have inherited lies, vanity, and things wherein there is no profit.”

Daniel 4:11
“The tree grew, and was strong, and the height thereof reached unto heaven, and the sight thereof to the ends of all the earth:”

(A spherical earth does not have ends.  It is continuous. And, in order to see a tall tree from everywhere on earth, the earth would have to be flat.  Not to mention a tree so tall it touches heaven.)

Matthew 4:8
“Again, the devil taketh him up into an exceeding high mountain, and sheweth him all the kingdoms of the world, and the glory of them; “

(The only way to see all the kingdoms of the earth from a mountain would be if the earth is flat.)

Belief in a flat earth based on biblical teachings has persisted to recent times.  The most recent champion of the movement, Charles Johnson, died in 2001 (See here.)  It just goes to show that people will go to any lengths to promote their particular interpretation of the Bible and that they can find “unequivocal” biblical support for virtually any interpretation they adopt, no matter how goofy it might be.

The fact Columbus used Bible quotes to cajole Queen Isabella into funding his sailing adventure is irrelevant to this discussion.  It was general knowledge among the enlightened citizenry that the earth was shaped like a sphere long before Columbus was born.  Pythagoras taught that the earth was a sphere in the 6th century BC.  Aristotle presented a number of lines of evidence for a spherical earth in 330 BC.  The circumference of the earth was quite accurately determined by Eratosthenes in 240 BC.  Ptolemy made significant contributions to the concept of a spherical earth in the 2nd century.  And most popular encyclopedias described a spherical earth by the 4th and 5th centuries.  Columbus did not need to misread the Bible to learn the earth was spheroid.  All he had to do was assimilate the common knowledge of the time.

Regarding Psa. 103:12, this passage is most readily understood in terms of a flat earth on which the east (the place where the sun begins its journey across the dome of the sky) and the west (where the sun goes to rest at night) were thought to be separated from one another by a great distance.  The Hebrew word used for east in this verse is “mizrach.”  The first definition given by Strong’s Lexicon for this word is the “place of sunrise.”  Similarly, the word for west is “ma’arab” which has as its primary meaning, the “place of setting.”  These words are commonly used in the Bible to denote a specific locality ,i.e., the east (a place where the sun rises) and the west (a place where the sun sets).  According to the ancient Hebrews, these points on the compass were not infinitely separated from each other.  However, they were widely separated due to their positioning at opposing edges of the flat earth.  Mr. Pyles’ contention that Psa. 103:12 refers to an infinite separation between us and our transgressions is not a doctrinal requirement of this verse.  The vast distance between the place where the sun rises and where it sets would most likely have provided more than enough separation for theological purposes.  Be that as it may, considering the worldview of the ancient Hebrews, only someone engaged in desperation hermeneutics would attempt to construe this verse as being indicative of a spherical earth.

In discussing one his favorite biblical topics, the blowing of the winds, Mr. Pyles calls attention to the fact that Solomon only mentions the winds blowing north and south in a circuit.  He contends that this makes sense from a scientific standpoint since “North and south are not infinitely separated as east and west…” and since, once a wind blowing north crosses the north pole, it starts blowing south.  (At least I think that is the point he is trying to get across.)  But what he fails to mention is the fact that the Bible also contains verses that that speak of “the four winds” that blow from all directions of the compass.  According to the KJV Concordance at the Blue Letter Bible website, the Bible makes reference to the four winds in nine different verses.  The biblical authors seem to have had a particular fascination with the east wind which is specifically mentioned in a number of verses, e.g., Jer. 18:17, Ezek. 27:26, Psa. 48:7, Isa. 27:8, and Hosea 12:1, 13:15.

Claim 22.

Isaiah 40:22 (written 2,800 years ago): “It is He that … stretches out the heavens as a curtain, and spreads them out as a tent to dwell in.”

Scientists are beginning to understand that the universe is expanding, or stretching out. At least seven times in Scripture we are clearly told that God stretches out the heavens like a curtain

My Response:

In Claim 2, Mr. Pyles asserts that the Bible says, “The creation was “finished” — once and for all.”  Now he says God is still busy stretching and spreading the heavens around. Which is it?  Is He done or is He still futzing around rearranging the draperies?  Mr. Pyles can’t have it both ways.

That is to say nothing of the fact that this verse describes the heavens as being equivalent to solid pieces of cloth.  This may represent good science reporting to Mr. Pyles, but I am sure most cosmologists would find it a bit off the mark.  This verse compares the heavens to the fabric portion of a tent, not to a three-dimensional universe many billions of light years across in which the earth is suspended.  In this regard, it is consistent with the ancient Hebrew’s mistaken belief that the heavens were composed of some kind of a solid material, the “firmament.”.   Any claim that this verse is referring to the expansion of the universe as it is understood by modern science is straw grasping at its most extreme.

Claim 23.

Hebrews 1:10,11 (written 2000 years ago): “… And, You, Lord, in the beginning have laid the foundation of the earth; and the heavens are the works of your hands: They shall perish; but you remain; and they all shall wax old as does a garment.”

The Bible tells us that the earth is wearing out. This is what the Second Law of Thermodynamics states. This wasn’t discovered by science until comparatively recently.

My Response:

It is common knowledge that most things tend to wear out as they age.  Even a TSIBAGH would have recognized that.  One does not have to be a physics major (or recipient of divine guidance) to make the connection that things generally degrade with usage over time.  All it takes is common observational skills.  Being aware of such things as landslides, rockslides, floods, earthquakes, collapsing buildings, etc. would lead to the conclusion that the earth was “wearing out” like everything else.  Any inference that the biblical author was somehow clued-in to the nuances of the Second Law of Thermodynamics is carrying the Bible science game to ridiculous extremes.  And what is this repeated nonsense about the earth having a foundation?

Claim 24.

Hebrews 11:3 (written 2000 years ago): “Through faith we understand that the worlds were framed by the word of God, so that things which are seen were not made of things which do appear.”

The Bible claims that all creation is made of invisible material. Science then was ignorant of the subject. We now know that the entire creation is made of invisible elements called “atoms.”

My Response:

To reiterate, science as we know it did not exist 2,000 years ago.  There was no formal scientific establishment at the time to be aware of or ignorant of anything.

This verse says that visible things are not made of things that can be visualized. But, as Mr. Pyles notes, visible things are made of atoms. However atoms are not invisible.  They can be visualized using tunneling electron microscopes and atomic force microscopes.  Apparently the author of Hebrews failed to anticipate this scientific achievement.  To look at some of those “invisible” atoms, see here.

The concept of the atom was first formally advanced by the Greek philosopher Demokritos at least 500 years before Hebrews was written. So contrary to Mr. Pyles’ claim, ignorance did not abound regarding the atomic structure of matter when Hebrews was written.  Since the idea was already floating around long before Hebrews was written, it is reasonable to assume its author might have gotten word of the hypothesis and incorporated it into his writings

Claim 25.

The Dinosaur (There is reasonable evidence that the scriptures speak of dinosaurs. As should be expected, this evidence comes from Genesis, the book of origins, and from the book of Job, generally believed to be the oldest book in the Bible.

First, Gn 1:21 speaks of God creating whales on the fifth day of creation. The Hebrew word translated here as whales is generally translated dragons. It is translated as monsters once, whale(s) twice, serpent(s) thrice, and dragon(s) 21 times.

Second, Job’s statements concerning the behemoth (Job 40:15-24) might be referring to dinosaurs. Its tail is compared to a cedar tree. Its strength, and apparently its bulk, is in its loins. It is said to be the chief of the ways of God, and is described as having the ability to drink up a river. No modern animal meets this description in all points.

Third, Job’s description of the leviathin (Job 41) very much resembles a dinosaur. Some would dismiss this description as fictitious because the leviathin is described as breathing fire; however, some creation scientists believe this could have happened. The creature would merely need glands to produce a chemical which would combust when exposed to air. The bombardier beetle does in fact have this ability. The fact that nearly every major culture of the world has traditions about such dragons lends yet further credibility to the possibility of their existence in the past. Examples of Scientific Accuracy in the Bible By David Pyles)

Why did the dinosaur disappear? This is something that has modern science mystified, but the Bible may have the answer (written 3500 years ago. God Himself is speaking):

[Mr. Pyles' repetition of Job 40:13-24 deleted for brevity.]

This was the Largest of all creatures He made.
It was plant-eating (herbivorous).
It had its strength in its hips.
Its tail was like a large tree (a cedar).
It had very strong bones.
Its habitat was among the trees.
Drank massive amounts of water.
His nose pierced through snares.

Then Scripture says, ” … He that made him can make his sword approach to him.” In other words, God caused this, the largest of all the creatures He had made, to become extinct.

My Response:

I have dealt with this claim elsewhere in my discussions with another Bible science promoter.  My comments can be found here and here (topics 1, 2, and 3).

To further address a couple of Mr. Pyles points, no animal on earth produces fire, nor has there ever been any scientific evidence that any animal that has ever lived has produced fire.  Fire destroys living tissue.  Bombardier beetles do not produce fire.  They produce a hot gas for defensive purposes as described here.

Contrary to Mr. Pyles’ assertion, scientists have advanced a number of evidence-based theories to account for the demise of the dinosaurs.  One of the most widely accepted theories involves the collision of an asteroid with the earth about 65 million years ago.  See here for details.  Certainly these theories have a lot more evidence to back them up than the speculation that God just one day decided to exterminate them all.

Just out of curiosity, I wonder why God would go to the trouble of creating dinosaurs (some 700 species at last count) and then wipe them off the face of the earth.  It seems to me like a rather cruel and unproductive thing to do – but not all that unexpected, I must admit, considering His rather schizophrenic behavior as depicted in the Bible.

Conclusion

“If the holy writer uses general terms, an ingenious theologian can harmonize a seemingly preposterous statement with the most obdurate fact.” (Robert Ingersoll’s Works, Vol. 5, p. 37).

Mr. Pyles, like other Bible science promoters, has made an effort to dredge selected scriptures from the morass of myth and superstition and to transform them into divinely-inspired gems of profound scientific insight.  Unfortunately, all he has accomplished has been to reveal to what ridiculous extremes people will go to try to rationalize their religious beliefs.

Mr. Pyles has focused on questionable scriptural translations. He has played word games with them, wrenched them out of context, and forced tortured, self-serving interpretations on them that are inconsistent with a straightforward reading.  He then attempts to impose upon them scientific attributes that are wholly unjustified when they are considered in their original contexts.  Like others who persist in trying to pound square pegs in round holes, he has succeeded only in demonstrating the futility of his foolish pursuit.

Mr. Pyles has not identified a single concept (scientific or otherwise) that has been “revealed” in the Bible that would have required anything other than common observational skills, a pre-scientific mentality, and a wild imagination to develop.  The Bible speaks uncritically of magical events like people being created from dust and ribs, talking snakes and donkeys, a burning bush that dispenses the voice of God, men who walk on water and live for hundreds of years, dead people miraculously returning to life, an earth covered by a solid dome, and all sorts of other unnatural acts and fantastical notions.  Early on it speaks of a talking snake and it ends with the story of a ten-horned, seven-headed monster.  It should be obvious to any rational individual that looking for scientific enlightenment from a book like that is clearly barking up the wrong tree.  Any resemblance between what is written in the Bible and modern scientific knowledge is purely coincidental.

In addition to the Bible verses discussed in this commentary, there are many others that demonstrate an appalling lack of scientific sophistication on the part of the biblical authors.  The Skeptic’s Annotated Bible identifies a number of these scientific anomalies at its website.  See also The Bible and Science.  After completing this commentary, I discovered an even more ambitious critique that addresses 101 Bible science claims. (See here.)  At least it is reassuring to see that others recognize the importance of exposing the inanity of such claims.

Source: Bible Science Debunked

 

Nobody owns science


Einstein is a deist, Darwin is an agnostic, and Newton, Kepler, and Mendel are Christians. Does it matter? No. What’s matter to me is the result of their scientific research.

They say, we should not appreciate those people and use their ideas because they are not atheists to begin with.

This kind of line of thinking or thought distortion directly reflect the framework of their thoughts. For instance, any scientific theory that doesn’t conform to Christian’s bible is automatically not true and should not be accepted as part of its dogma. Likewise, any idea created or authored by non-atheists should not be accepted or use by atheists.

To begin with, science is borderless. It does not support any belief system. The problem is, we have this tendency to use science as to validate our prenotion of reality.

This give us idea that as if every scientist represents as a validator of his own belief system. As if there is an atheist scientist or theist scientist or agnostic scientist or deist scientist. Do you know what does it mean? It means, a scientist for atheism or a scientist for theism. That’s not true. The truth is, Newton, for example, a physicist who happens to be a Christian, but he’s not a physicist representing for Christianity.

Therefore, it is misleading to say since these people are not atheists, we should not appreciate them and use their ideas to make a point.

 

Denialism: what is it and how should scientists respond?


Citation: Eur J Public Health (2009) 19 (1):2-4.doi: 10.1093/eurpub/ckn13

Authors: Pascal Diethelm and Martin McKee

 

Black is white and white is black

HIV does not cause AIDS. The world was created in 4004 BCE. Smoking does not cause cancer. And if climate change is happening, it is nothing to do with man-made CO2 emissions. Few, if any, of the readers of this journal will believe any of these statements. Yet each can be found easily in the mass media.

The consequences of policies based on views such as these can be fatal. Thabo Mbeki’s denial that that HIV caused AIDS prevented thousands of HIV positive mothers in South Africa receiving anti-retrovirals so that they, unnecessarily, transmitted the disease to their children. His health minister, Manto Tshabalala-Msimang, famously rejected evidence of the efficacy of these drugs, instead advocating treatment with garlic, beetroot and African potato. It was ironic that their departure from office coincided with the award of the Nobel Prize to Luc Montagnier and Françoise Barré-Sinoussi for their discovery that HIV is indeed the case of AIDS. The rejection of scientific evidence is also apparent in the popularity of creationism, with an estimated 45% of Americans in 2004 believing that God created man in his present form within the past 10 000 years. While successive judgements of the US Supreme Court have rejected the teaching of creationism as science, many American schools are cautious about discussing evolution. In the United Kingdom, some faith-based schools teach evolution and creationism as equally valid ‘faith positions’. It remains unclear how they explain the emergence of antibiotic resistance.

Elsewhere, the hand of powerful corporate interests can be seen. It took many decades for the conclusions of authoritative reports by the US Surgeon General and the British Royal College of Physicians on the harmful effects of smoking to be accepted, while even now, despite clear evidence of rapid reductions in myocardial infarctions where bans have been implemented, there are some who deny that second-hand smoke is dangerous. In large part this was due to the efforts of the tobacco industry to deflect attention to other putative causes of smoking-related diseases, from stress to keeping pet birds. The reports of the Intergovernmental Panel on Climate Change have suffered similar attacks from commentators with links to major oil companies.

All of these examples have one feature in common. There is an overwhelming consensus on the evidence among scientists yet there are also vocal commentators who reject this consensus, convincing many of the public, and often the media too, that the consensus is not based on ‘sound science’ or denying that there is a consensus by exhibiting individual dissenting voices as the ultimate authorities on the topic in question. Their goal is to convince that there are sufficient grounds to reject the case for taking action to tackle threats to health. This phenomenon has led some to draw a historical parallel with the holocaust, another area where the evidence is overwhelming but where a few commentators have continued to sow doubt. All are seen as part of a larger phenomenon of denialism.

Defining and recognizing denialism

The Hoofnagle brothers, a lawyer and a physiologist from the United States, who have done much to develop the concept of denialism, have defined it as the employment of rhetorical arguments to give the appearance of legitimate debate where there is none, an approach that has the ultimate goal of rejecting a proposition on which a scientific consensus exists. In this viewpoint, we argue that public health scientists should be aware of the features of denialism and be able to recognize and confront it.

Denialism is a process that employs some or all of five characteristic elements in a concerted way. The first is the identification of conspiracies. When the overwhelming body of scientific opinion believes that something is true, it is argued that this is not because those scientists have independently studied the evidence and reached the same conclusion. It is because they have engaged in a complex and secretive conspiracy. The peer review process is seen as a tool by which the conspirators suppress dissent, rather than as a means of weeding out papers and grant applications unsupported by evidence or lacking logical thought. The view of General Jack D Ripper that fluoridation was a Soviet plot to poison American drinking water in Dr Strangelove, Kubrick’s black comedy about the Cold War is no less bizarre than those expressed in many of the websites that oppose this measure.

In some cases, denialism exploits genuine concerns, such as the rejection of evidence on the nature of AIDS by African-Americans who perceive them as a manifestation of racist agendas. While conspiracy theories cannot simply be dismissed because conspiracies do occur, it beggars belief that they can encompass entire scientific communities.

There is also a variant of conspiracy theory, inversionism, in which some of one’s own characteristics and motivations are attributed to others. For example, tobacco companies describe academic research into the health effects of smoking as the product of an ‘anti-smoking industry’, described as ‘a vertically integrated, highly concentrated, oligopolistic cartel, combined with some public monopolies’ whose aim is to ‘manufacture alleged evidence, suggestive inferences linking smoking to various diseases and publicity and dissemination and advertising of these so-called findings to the widest possible public’.

The second is the use of fake experts. These are individuals who purport to be experts in a particular area but whose views are entirely inconsistent with established knowledge. They have been used extensively by the tobacco industry since 1974, when a senior executive with R J Reynolds devised a system to score scientists working on tobacco in relation to the extent to which they were supportive of the industry’s position. The industry embraced this concept enthusiastically in the 1980s when a senior executive from Philip Morris developed a strategy to recruit such scientists (referring to them as ‘Whitecoats’) to help counteract the growing evidence on the harmful effects of second-hand smoke. This activity was largely undertaken through front organizations whose links with the tobacco industry were concealed, but under the direction of law firms acting on behalf of the tobacco industry. In some countries, such as Germany, the industry created complex and influential networks, allowing it to delay the implementation of tobacco control policies for many years. In 1998, the American Petroleum Institute developed a Global Climate Science Communications Plan, involving the recruitment of ‘scientists who share the industry’s views of climate science [who can] help convince journalists, politicians and the public that the risk of global warming is too uncertain to justify controls on greenhouse gases’. However, this is not limited to the private sector; the administration of President George W Bush was characterized by the promotion of those whose views were based on their religious beliefs or corporate affiliations, such as the advisor on reproductive health to the Food and Drug Administration who saw prayer and bible reading as the answer to premenstrual syndrome. A related phenomenon is the marginalization of real experts, in some cases through an alliance between industry and government, as when ExxonMobil successfully opposed the reappointment by the US government of the chair of the Intergovernmental Panel on Climate Change. These events led a group of prominent American scientists to state that ‘stacking these public committees out of fear that they may offer advice that conflicts with administration policies devalues the entire federal advisory committee structure’.

The use of fake experts is often complemented by denigration of established experts and researchers, with accusations and innuendo that seek to discredit their work and cast doubt on their motivations. Stanton Glantz, professor of medicine at the University of California, San Francisco and who has made a great contribution to exposing tobacco industry tactics, is a frequent target for tobacco denialists. He is described on the Forces website as ‘infamous for being the boldest of liars in “tobacco control” that most ethically challenged gang of con artists’, adding that ‘he cynically implies his research into smoking is science, banking on the sad fact that politicians, let alone the media, have no idea that epidemiology is not real science and that his studies define the term junk science’.

The third characteristic is selectivity, drawing on isolated papers that challenge the dominant consensus or highlighting the flaws in the weakest papers among those that support it as a means of discrediting the entire field. An example of the former is the much-cited Lancet paper describing intestinal abnormalities in 12 children with autism, which merely suggested a possible link with immunization against measles, mumps and rubella. This has been used extensively by campaigners against immunization, even though 10 of the paper’s 13 authors subsequently retracted the suggestion of an association. Fortunately, the work of the Cochrane Collaboration in promoting systematic reviews has made selective citation easier to detect.

Another is a paper published by the British Medical Journal in 2003, later shown to suffer from major flaws, including a failure to report competing interests, that concluded that exposure to tobacco smoke does not increase the risk of lung cancer and heart disease. This paper has been cited extensively by those who deny that passive smoking has any health effects, with the company Japan Tobacco International still quoting it as justification for rejecting ‘the claim that ETS is a cause of lung cancer, heart disease and chronic pulmonary diseases in non-smokers’ as late as the end of 2008.

Denialists are usually not deterred by the extreme isolation of their theories, but rather see it as the indication of their intellectual courage against the dominant orthodoxy and the accompanying political correctness, often comparing themselves to Galileo.

The fourth is the creation of impossible expectations of what research can deliver. For example, those denying the reality of climate change point to the absence of accurate temperature records from before the invention of the thermometer. Others use the intrinsic uncertainty of mathematical models to reject them entirely as a means of understanding a phenomenon. In the early 1990s, Philip Morris tried to promote a new standard, entitled Good Epidemiological Practice (GEP) for the conduct of epidemiological studies. Under the GEP guidelines, odds ratios of 2 or less would not be considered strong enough evidence of causation, invalidating in one sweep a large body of research on the health effects of many exposures. Although Philip Morris eventually scaled back its GEP programme, as no epidemiological body would agree to such a standard, British American Tobacco still uses this criterion to refute the risk associated with passive smoking.

The fifth is the use of misrepresentation and logical fallacies. For example, pro-smoking groups have often used the fact that Hitler supported some anti-smoking campaigns to represent those advocating tobacco control as Nazis (even coining the term nico-nazis), even though other senior Nazis were smokers, blocking attempts to disseminate anti-smoking propaganda and ensuring that troops has sufficient supplies of cigarettes. Logical fallacies include the use of red herrings, or deliberate attempts to change the argument and straw men, where the opposing argument is misrepresented to make it easier to refute. For example, the US Environmental Protection Agency (EPA) determined in 1992 that environmental tobacco smoke (ETS) is carcinogenic, a finding confirmed by many other authoritative national and international public health institutions. The EPA assessment was described by two commentators as an ‘attempt to institutionalize a particular irrational view of the world as the only legitimate perspective, and to replace rationality with dogma as the legitimate basis of public policy’, which they labelled as nothing less than a ‘threat to the very core of democratic values and democratic public policy’. Other fallacies used by denialists are false analogy, exemplified by the argument against evolution that, as the universe and a watch are both extremely complex, the universe must have been created by the equivalent of a watchmaker and the excluded middle fallacy (either passive smoking causes a wide range of specified diseases or causes none at all, so doubt about an association with one disease, such as breast cancer, is regarded as sufficient to reject an association with any disease).

Responding to denialism

Denialists are driven by a range of motivations. For some it is greed, lured by the corporate largesse of the oil and tobacco industries. For others it is ideology or faith, causing them to reject anything incompatible with their fundamental beliefs. Finally there is eccentricity and idiosyncrasy, sometimes encouraged by the celebrity status conferred on the maverick by the media.

Whatever the motivation, it is important to recognize denialism when confronted with it. The normal academic response to an opposing argument is to engage with it, testing the strengths and weaknesses of the differing views, in the expectations that the truth will emerge through a process of debate. However, this requires that both parties obey certain ground rules, such as a willingness to look at the evidence as a whole, to reject deliberate distortions and to accept principles of logic. A meaningful discourse is impossible when one party rejects these rules. Yet it would be wrong to prevent the denialists having a voice. Instead, we argue, it is necessary to shift the debate from the subject under consideration, instead exposing to public scrutiny the tactics they employ and identifying them publicly for what they are. An understanding of the five tactics listed above provides a useful framework for doing so.

 

Source: Denialism: what is it and how should scientists respond?

 

The importance of peer-review on evolutionary theory.


One of the reasons why I keep on asking that we have to provide actual scientific citation is because in order to eliminate folk sciences or our limited knowledge of science especially on the theory of evolution so that the discussion can have a scientific perspective or position. Treating folk sciences as if they have scientific status even if in the absence of actual research can only lead to misconception and more confusion to the subject matter. I am not saying we have to ignore folk science. The point that I’m going to raise here is that we need to have actual studies supporting the claims instead of relying heavily on personal views or biases and treated them as if they have scientific status.

The problem of non-peer-reviewed papers is that they don’t observe the concept of peer-review. Therefore they don’t have equal merits and cannot be treated as if they have a scientific status. I am not saying the arguments from those papers are automatically invalid.

The point is we need to have actual research papers to the argument we are attempting to prove instead of relying heavily on personal analysis of the issue on hand. We need to have actual data to prove a claim; not by wishing the other argument is wrong simply because they have contradicted our notion of reality or the argument is unsupported by actual studies.

Another thing is, proving a positive claim thing. The argument that “evolution did not occur” and or “I know evolution is not true” is a positive claim. In logic, the one who makes a positive claim is obliged to demonstrate his/her claim is true. In science we have this thing called Falsificationism. We have to demonstrate any positive claim to prove that the  claim holds water or not. So, actual research published papers are so important when it comes to proving and disproving a claim. That is why I keep on posting actual published papers instead of posting opinion-based articles from pro-evolutionists.

As of the accusation that “we treated the theory of evolution as dogma” has no basis at all. In fact, the one who treated their theories dogmatically are the theories of anti-evolutionists since even in the absence of actual research they are treating them as if they have scientific status and masquerading as they are legitimate scientific theories. That is a classic example of psychological projection at its best there is. Now, if we are going to analyze the history of science, we all know that there are theories from the past that have been abandoned everytime new superior theories arrived. As long as the current theory supported by actual research and data then we have to accept it as if it contains a kernel of truth. If the new superior theory arrives then we have no choice but to abandon it. So far the theory of evolution still stands.

As of the argument that the theory predicts nothing then let us see:

The theory of evolution can predict where to find evidence, where each species is a descendant of a parent species, and it can predict which features will evolve. For instance:
• Darwin predicted, based on homologies with African apes, which human ancestors arose in Africa. That prediction has been supported by fossil and genetic evidence (Ingman et al. 2000).
• Humans did come out of Africa. (Ingman, M., Kaessmann, H., Pä ä ba, S. & Gyllensten, U. Mitochondrial genome variation and the origin of modern humans. Nature 408, 708 – 713 2000.)
• Theory predicted that organisms in heterogeneous and rapidly changing environments should have higher mutation rates. This has been found in the case of bacteria infecting the lungs of chronic cystic fibrosis patients (Oliver et al. 2000).
• Predator-prey dynamics are altered in predictable ways by evolution of the prey (Yoshida et al. 2003).
• Ernst Mayr predicted in 1954 that speciation should be accompanied with faster genetic evolution. A phylogenetic analysis has supported this prediction (Webster et al. 2003).
• Several authors predicted characteristics of the ancestor of craniates. On the basis of a detailed study, they found the fossil Haikouella “fit these predictions closely” (Mallatt and Chen 2003).
• Evolution predicts that different sets of character data should still give the same phylogenetic trees. This has been confirmed informally myriad times and quantitatively, with different protein sequences, by Penny et al. (1982).
• Phylogenomic evidence of adaptive evolution in the ancestry of humans (Morris Goodmana and Kirstin N. Sternera 2009).
• Insect wings evolved from gills, with an intermediate stage of skimming on the water surface. Since the primitive surface-skimming condition is widespread among stoneflies, J. H. Marden predicted that stoneflies would likely retain other primitive traits, too. This prediction led to the discovery in stoneflies of functional hemocyanin, used for oxygen transport in other arthropods but never before found in insects (Hagner-Holler et al. 2004; Marden 2005).
• Host sexual dimorphism and parasite adaptation (Duneau D, Ebert D 2012)).
• Evolution of the Vertebrate Gene Regulatory Network Controlled by the Transcriptional Repressor REST (Johnson et al. 2009).

As of natural selection has no evidence: I have read that there is no single evidence for natural selection from anti-evolutionists in this group: A Scientific Inquiry Into The General Theory Of Evolution. Anyway, here are the links: Darwinian natural selection: its enduring explanatory power by Gregory G. Dimijian, MD.http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3310512/pdf/bumc0025-0139.pdf and Popper on natural selection’s testability:http://www.talkorigins.org/indexcc/CA/CA211.1html.

Here are some actual published papers supporting natural selection:

1. Sequence Diversity at the Proximal 14q32.1 SERPIN Subcluster Evidence for Natural Selection Favoring the Pseudogenization of SERPINA2
2. Evidence for evolution in response to natural selection in a contemporary human population: http://www.pnas.org/content/108/41/17040.full
3. Darwin’s beautiful contrivances: evolutionary and functional evidence for floral adaptation: DOI: 10.1111/j.1469-8137.2009.02914.x
4. Natural selection on EPAS1 (HIF2α) associated with low hemoglobin concentration in Tibetan highlanders: doi: 10.1073/pnas.1002443107
5. Population thinking and natural selection in dual-inheritance theory:http://link.springer.com/article/10.1007/s10539-012-9307-5/fulltext.html
6. Evaluating the role of natural selection in the evolution of gene regulation: doi:10.1038/sj.hdy.6801000
7. Natural selection acts on the quantum world: doi:10.1038/news041220-12
8. Comparative genomics and the study of evolution by natural selection: DOI: 10.1111/j.1365-294X.2008.03954.x
9. Natural selection, evolvability and bias due to environmental covariance in the field in an annual plant
10. Identifying Signatures of Natural Selection in Tibetan and Andean Populations Using Dense Genome Scan Data
11. The Young, the Weak and the Sick: Evidence of Natural Selection by Predation
12. On Theoretical Models of Gene Expression Evolution with Random Genetic Drift and Natural Selection
13. Temporal Trails of Natural Selection in Human Mitogenomes
14. Implications of natural selection in shaping 99.4% nonsynonymous DNA identity between humans and chimpanzees. Enlarging genus Homo
15. Natural selection stops the evolution of male attractiveness
16. Periodic Scarred States in Open Quantum Dots as Evidence of Quantum Darwinism: DOI: 10.1103/PhysRevLett.104.176801
17. Natural and sexual selection in a monogamous historical human population: doi: 10.1073/pnas.1118174109
18. Modes of response to environmental change and the elusive empirical evidence for bet hedging: doi: 19.1098/rspb.2011.0176

Now, if we have actual research papers eliminating the possibility of evolution kindly post here.

 

Science and its Discontents: Is There an End to Knowing?


How to Cite

Shkliarevsky, G. (2013), Science and its Discontents: Is There an End to Knowing?. Syst. Res., 30: 43–55. doi: 10.1002/sres.2127

Author Information

  1. Bard College, Professor of History, Department of History, Bard College, NY, USA

* Gennady Shkliarevsky, Bard College, Professor of History, Department of History, Bard College, Annandale-on-Hudson, NY 12504, USA. E-mail: shkliare@bard.edu

Publication History                                                          

  1. Issue published online: 14 JAN 2013
  2. Article first published online: 31 JUL 2012
  3. Manuscript Accepted: 20 JUN 2012
  4. Manuscript Received: 8 DEC 2011

Abstract

Is there an end to our scientific quest? This question that continues to divide the scientific community between those who believe that the progress of science is infinite and those who think that we already understand how the universe works and no major discoveries are to be expected in the future. This article explores the philosophical worldview of modern science that has given rise to this question. It argues that an approach to knowledge that focuses on the process of construction of knowledge rather than its products offers a possibility of definitively answering this question and opening paths for a more rational approach in advancing and managing the scientific progress. Copyright © 2012 John Wiley & Sons, Ltd.

In 1996, John Horgan, then a senior writer for Scientific American, wrote a book that made quite a stir in the science community. The title of the book was very provocative: The End of Science: Facing the Limits of Knowledge in the Twilight of the Scientific Age (Horgan, 1996). As the title indicates, the author made a claim that modern science had reached its limit. Horgan argued that although some incremental progress was still occurring and might even continue to occur for some time, nothing comparable to the theory of relativity, quantum mechanics or the discovery of the structure of DNA was even in the realm of possibilities. Science simply already made all the major advances there were to be made; our understanding of how the universe worked was, on the whole, completed.

Responses to Horgan’s book revealed sharp divisions in the scientific community. Numerous disagreements with the arguments and the main conclusion of the book ranged from well-mannered academic criticisms to sharp vitriolic attacks. John Maddox, former editor of the Science magazine, for example, produced a lengthy book entitled What Remains to Be Discovered in which he politely challenged Horgan’s contentions and outlined major areas of science where significant advances should take place in the future. By contrast, biologist Stephen Gould described Horgan’s book as ‘boring’ and physicist Stephen Hawking called it ‘nonsense’. There were also much harsher reactions that revealed raw emotions, irritation and even anger. Horgan was called a quack and a phony whose views of contemporary science were extremely subjective, ill informed and very biased.

However, there were a significant number of scientists who, on the whole, agreed with Horgan’s arguments and did not dispute his reading of the facts. Like Horgan, they believed that in its main contours, the work of science had been completed and no major illuminations awaited us in the future. Biologist Kenneth Miller, for example, observed that ‘at the core of his [Horgan's] thesis was an observation that met with agreement among most of the scientists I know—namely, that in a general way, we really do understand how nature works’ (Horgan, 2008, p. 43).

The book definitely touched the nerve in the scientific community. Unlike some critics of science from among its opponents (e.g., religious extremists), Horgan was, for many decades (and continues to be), an integral part of the scientific scene. He was well informed about scientific developments and had written a great deal on the subject. He received numerous awards for his writings about science; his contributions appeared in some of the most prestigious publications both in the United States and around the world. He personally knew many distinguished scientists. In a word, Horgan was definitely an insider. His pessimistic conclusions did not spring up from some anti-scientific persuasion but from the very midst of the modern scientific scene.

By his own admission, Horgan was a believer in the open-endedness of science and its infinite progress. His first doubts appeared at the end of the 1980s largely in response to proud affirmations of the capacity of modern science to solve the remaining mysteries of the universe. Stephen Hawking, for example, categorically declared in 1988 that there was a good chance that ‘the study of the early universe and the requirements of mathematical consistency will lead us to a complete unified theory within the lifetime of some of us who are around today’ (Horgan, 2008, p. 43). Although Hawking later retracted this statement (Hawking, 2003), there are still many physicists who continue the search for the elusive final theory of everything. The European Organization for Nuclear Research (CERN) has spent over 10 billion dollars on the Large Hadron Collider to search for the so-called god particle—the Higgs boson—that is supposed to explain gravity and, thus, solve the last mystery of the physical universe. What is going to happen when the last mystery is solved? Where would physics go then? In his book, The End of Science, Horgan describes his interview in 1989 with distinguished physicist Roger Penrose. Their conversation drifted to the theory of everything—a theory that is supposed to unite all known physical forces in nature and provide the ultimate answer to the puzzle of the universe. ‘Solving mysteries is a wonderful thing to do’, Penrose ruminated. ‘And if they were all solved, somehow, that would be rather boring’ (Horgan, 1996, p. 3).

Penrose’s words were a revelation for Horgan. Indeed, if the final theory is attained, what does it mean for the scientific enterprise? Does that mean the end of the scientific quest? After all, how much is there to know? As we learn more about the fundamental aspects of reality, is it possible that we will one day learn it all? ‘In the same way’, Horgan argues, ‘scientists might be unlikely to discover anything surpassing the big bang, or quantum mechanics, or relativity, or natural selection, or DNA-based genetics’ (Horgan, 2004, p. 38).

The publication of The End of Science has had no significant practical consequences for the scientific community. Scientists continue to do their research as they had had for many years before the publication of the book. The controversy has largely subsided. However, the problem that the book raised has not gone away, and the questions the book asked have remained unanswered (Ben-Ari, 2007), and they are interesting questions. Indeed, many of us are brought up to believe that the progress of science and knowledge will be infinite. However, why should this progress be infinite? Can our belief be proven? In his review of John Maddox’s riposte to Horgan for The New York Times, Paul Raeburn, while recognizing that Maddox makes a persuasive case for the future development of science, adds

Does that mean Horgan was wrong? It may take a few centuries to find out. Horgan recalls the early explorers, to whom the swelling seas seemed infinite. They were wrong; but perhaps the belief sustained them (The New York Times, January 10, 1999).

The debates that have followed the publication of The End of Science have largely focused on whether Horgan is right or wrong. This approach has not proven to be particularly productive. No consensus has emerged between those whom Mordechai Ben-Ari calls accelerationists and the end-of-science scholars (Ben-Ari, 2007, p. 20). This paper will take a different approach. Rather than deal with the existing division among scientists and decide who is right and who is wrong, it will focus on the possible source of this problem. Why has this problem come up in the first place? What is it in the contemporary scientific worldview that has made the emergence of this problem possible? To answer this question, one needs to examine the worldview of contemporary science.

The philosophical perspective that dominates modern scientific worldview is realism. John Searle provides the following succinct definition of realism:

Realism is the view that there is a way that things are that is logically independent of all human representations. Realism does not say how things are but only that there is a way that they are (Searle, 1995, p. 155; emphasis in the original).

According to Searle, the realist view of the world has the following structural features (Searle, 1995, pp. 150–51)1:

  1. World (or alternatively, reality or the universe) exists independently of our representations of it.
  2. Human beings have a variety of interconnected ways of having access to and representing features of the world to themselves.
  3. Some of these representations .purport to be about and to represent how things are in reality. To the extent that they succeed or fail, they are said to be true or false, respectively. They are true if and only if they correspond to the facts in reality.
  4. Systems of representation are human creations, and to that extent arbitrary.
  5. Complete epistemic objectivity is difficult, sometimes impossible.
  6. Having knowledge consists in having true representations for which we can give certain sorts of justification or evidence. Knowledge is thus by definition objective in the epistemic sense, because the criteria for knowledge are not arbitrary, and they are impersonal.

As one can see from the above, the realist perspective does not promise a complete knowledge of reality; rather, and rather pessimistically, it promises only an infinite asymptotic approximation to such knowledge. Also, according to this perspective, our knowledge in the final analysis depends on the reality external to our mind; this reality is the ultimate arbiter in determining what constitutes knowledge and what does not. Validation of knowledge involves a fit between a theory and the way things are. As a definition standard among realists goes, knowledge is ‘justified true belief’. It means that to constitute knowledge a belief must be true, that is, it should correspond, at least approximately, to the way reality is independently of our theory (David, .; Searle, 1995; Otte, 1990; Weston, 1992). In other words, the fit is a necessary condition of knowledge; without it, a belief cannot be considered true and, therefore, cannot constitute knowledge.

Thus, as one can see, the dominant view of modern science is that reality external to our mind validates scientific knowledge. It is only fair to acknowledge that on close reading the view of validation implies a strong possibility that science may indeed come to an end or at least to an end of big discoveries. One can submit several considerations in support of this apparent possibility. First of all, because of our constitution and the constitution of the physical universe, our access to the reality external to our mind and available for validation is limited. According to modern science, we live in a universe where nothing can exceed the speed of light. This universe may or may not be infinite, but because of our physical limitations and the laws of nature, we can physically see only so far in our universe. Our universe has a horizon beyond which our gaze does not penetrate. To put it simply, we cannot see or hear anything that does not reach us. The Big Bang is the ultimate limit to how far we can see into the history of our universe. Also, we cannot see what is going on inside a black hole because gravity prevents light from reaching us. Still, another example of what one might call a natural limitation is the principle of uncertainty that is widely accepted in our theorizing about subatomic events. In accordance with this principle, there is no way we can know the actual state of a particle or a quantum system as it is irrespective of our experimental tools. We cannot, in principle, know the exact state of reality at the subatomic level but only its statistical probability.

This is not to argue that our universe is infinite or finite. It may very well be infinite, but we have access only to its finite part. Because the accepted method of validation requires the establishment of one-to-one correspondence, our knowledge about the inaccessible part of the universe cannot be validated and, therefore, does not constitute, according to the existing standards, proper knowledge. It is simply a speculation at best.

Second, our current theory of evolution also supports the view that our capacity to know, even when enhanced by technological devices, is limited. The evolution made us fit to survive in this world, not to know it; our senses are shaped by the evolution for the purposes of survival. Our knowledge that, according to science, is based on our senses is merely a survival tool. In other words, we need knowledge only to the extent required by our survival, and because there are aspects of reality that are not essential for our survival, we may very well never know anything about them. Finally, science is about discovering the laws of nature, and the number of these laws, however big it may be, still must be finite. If it were not, reality would be chaotic, and it is not. Therefore, there are only so many laws of nature that we can discover.

In light of these considerations, one may very well conclude that reality accessible to us limited creatures is limited and therefore our knowledge of it also has a limit. Moreover, according to realism, we may be able only to approximate this limit without ever reaching it. In accordance with the dominant approach to validation of knowledge, whatever ideas or beliefs we may form about the rest of reality, these ideas and beliefs cannot, in principle, be validated and, therefore, cannot constitute knowledge.

Although the realist perspective on knowledge dominates the modern scientific worldview, it is not unopposed. There are numerous philosophical perspectives that disagree with realism. Despite their differences and even incompatibilities, they share some common features and are usually grouped together under the general rubric of anti-realism (for an overview of realism and anti-realism, see Psillos, 1999; Ladyman, 2001; Searle, 1995). Broadly speaking, anti-realism is a philosophical critique of the main tenets of realism. It is beyond the scope of this paper to go into all the specifics of issues contested by realism and anti-realism. Although their number is extensive, they largely boil down to one fundamental disagreement over the issue of validation. In contrast to realists, anti-realists maintain that we can never be sure how things actually are because a fit between a theory and data is insufficient for truth claims. Paul Horwich, for example, offers the following generalization:

It [anti-realism] derives from an impression of conflict between the alleged autonomy of the facts (their independence of us) and their accessibility (the possibility of our gaining knowledge of their existence). Consequently, it seems to the anti-realist that something of our naive point of view must be given up; some philosophical move must be made (Horwich, 1996, p. 188).

In support of their argument, anti-realists refer to numerous theories in the past that fitted well with empirical data but have ultimately proven to be false (e.g., the theory of flat Earth, the theory that placed Earth in the center of our planetary system or the ether theory of light). They also point to the phenomenon of underdetermination (i.e., the existence of different and often conflicting theories that are supported by the same empirical evidence) as a proof that a fit is no guarantee of the validity of a theory (on underdetermination, see Hoefer and Rosenberg, 1994; Leplin, 1997; Bergström, 1984; Cordero, 2001; Belousek, 2005).

As one can see, in the anti-realist perspective, we cannot make truth claims based on the validation by a fit between theory and fact. In this perspective, knowledge is not circumscribed by external reality and, therefore, is not limited to the states that the world may be in. Clearly, such view frees knowledge from being dependent on reality for validation; the progress of knowledge can be infinite. However, this freedom comes at a price. In accordance with the anti-realist view, this knowledge is not about anything except our capacity to create. Knowledge has nothing to do with truth; it is relativistic. Although anti-realists reject the realist approach to validation, they offer no adequate approach of their own.

Thus, the realist position maintains that science can attain true knowledge about reality, but the dependence that they establish between knowledge and the reality external to our mind cannot explicitly reject a possibility that scientific exploration may, at some point, come to an end. The anti-realist perspective, on the other hand, provides a strong support to the idea that the progress of our knowledge is infinite, but they also assert that this knowledge has little, if anything, to do with the way reality actually is. Neither of these positions seems to be satisfactory. We are reluctant to accept the notion that our scientific exploration will come to an end, but at the same time, we do not want to give up the notion that our science provides us with true understanding of how things are. Unfortunately, there just does not seem to be any possibility for reconciling these two positions.

For the purposes of this paper, I want to point out that despite significant differences between the realists and the anti-realists, in one very important respect, their worldviews are very similar: they both posit a gap between the subject and the object. As has already been indicated, the realists believe that this gap can be mediated, whereas the anti-realists think that such mediation is impossible. The gap between the knower and reality indicates that traditional dualism still plays an important role in both perspectives. This dualism can be traced back to the early periods in the evolution of human thought. Plato, for example, believed that mind and body were ontologically distinct. The division between thought and reality, mind and matter, body and soul, subject and object, and the knower and the known is characteristic for much of the European, and not only European, intellectual tradition (Dickens, 2010; Robinson, 2011).2 However, is the positing of this gap justified? Is it supported by empirical evidence?

In his remarkable study, The Origin of Intelligence in Children and in his other books, Piaget provides a very detailed empirical account and analysis of the development of symbolic thought (Piaget, 1998). Piaget shows that the process of construction of symbolic representations is bi-directional. On one hand, it constructs mental representations of objects, and on the other, it also develops consciousness or what we often call the subject. Thus, one can see that the same process is involved in the construction of both the subject and the object and intimately relates one to the other. The constructed object and the constructed subject are not mere mental categories; they are represented by the physical organization of neurons and neural networks.

Based on what we know about the way our thinking operates, we can conclude the following:

  1. There is no ontological gap that separates the subject and the object. The ontological status of this gap is not supported by empirical evidence. Both the subject and the object are products of the same process of construction.
  2. The ontological distinction between thought and reality is also unsupported by empirical evidence. As organization of neurons and neural networks, thought is merely one of the forms of organization of reality. In other words, it is reality. In fact, it is the most powerful form of organization of reality. Unlike other forms of organization of reality, the process of organizing and re-organizing neurons and neural circuits has no limitations and is capable of infinite number of combinations.

Empirical evidence shows that symbolic thought emerges as a result of combinations of neural networks that conserve sensori-motor operations by regulating them. Although neural networks regulate sensori-motor operations, they, in turn, also need to be conserved—the function that is performed by their own regulatory operations. The combination of these regulatory operations leads to the emergence of mental images—a new level of organization represented by a new functioning organization of neurons and neural circuits. The conservation of these new functioning operations also requires regulatory operations and so on and so forth. Thus, conservation and regulation play a crucial role in the creation of new forms of organization of reality. Conservation is the real drive of this process, and regulation makes conservation possible. Conservation of regulatory operations also requires regulation of these operations. It is always possible and even necessary for the purposes of conservation to construct another level of regulation. Given the number of neurons in an average human brain and their plasticity—the fact that there are no physical limitations to their combinatorial capacity—the number of possible combinations that their networks can compose is infinite.

It is also important to remember that the evolution of human thought has an important social dimension. Conservation of symbolic representations also takes place in the inter-subjective space, not just inside an individual brain. Human thinking evolved as a cooperative social activity. Language is an important tool that serves this inter-subjective mode of conservation and symbolic construction. The spontaneous organization of interacting brains combined with technology that supports and enhances our mental activity (such as computers, the internet, various data repositories, etc.) vastly increases our capacity to construct new forms of organization of reality with increased combinatorial power. Each new level of organization is more powerful than the one it regulates because it offers more combinatorial possibilities; the forms of organization that each new level regulates become merely particular cases in a more general organized whole. Unlike other forms of organization of reality, organization of reality that involves symbolic thought has no limitations; it is, in fact, infinite.

The empirical evidence related to the emergence and development of human thought does not support the positing of the ontological gap between thought and reality, mind and matter, subject and object, the knower and the object of knowing. This gap is not a product of empirical observation; it is an example of what Kant called synthetic a priori judgment or what we more commonly call self-evident or common sense truth. As the term indicates, common sense truth is not a product of rational judgment. The word ‘sense’ indicates connection to biological factors, whereas the word ‘common’ suggests coherence—the fact that this knowledge is a product of an agreement among knowers. Neither of these terms signifies any connection to rational and critical assessment. The commonly accepted belief regarding the unbridgeable gap that separates the subject from the object does not exist in reality. It appears only if the process of construction is excluded from our conception of knowledge production. We all have an immediate experience of this process. Without it, we would not be able to know anything. It is real and so are its products—new forms of organization of reality represented by new organizations of neurons and neural circuits.

The controversy that has surfaced in connection with Horgan’s book is not accidental. Its source is the worldview held by contemporary science and, specifically, its conception of knowledge production. This conception fails to recognize and embrace the very source of our knowledge—the process of construction that generates reality. Our knowledge production is an integral part of this process. Our capacity to produce knowledge is infinite. This capacity is the most compelling proof against Horgan’s assertion that our scientific quest will come to an end. It is also a convincing proof—in fact, the only definite proof we can have—that reality is infinite because our capacity to shape and reshape it is infinite. We are the agents who have the potential to make reality infinite, and our true destiny as a civilization is to realize this potential.

The controversy that this article originally set out to explore leads to a different set of questions that transcend the boundaries of its original subject. How do we realize our infinite potential for constructing reality? What are the best conditions to sustain and enhance this potential? How will its realization affect our life?

These questions are not new. Many thinkers from the Renaissance through the Enlightenment and down to our own time have asked these questions in one form or another. They were captivated by the power of human thought; many of them devoted their lives and careers to seeking ways in which the power of human intellect could be harnessed for the benefit of humanity. Their visions continue to inspire us in our quest for infinite progress, rationally organized political and social order, economic prosperity, and world without violence and wars. Although these goals remain elusive, the inspiration is enduring. We continue to believe that control over the power of our knowing will open unlimited possibilities for humanity.

C. West Churchman is one of the most important and influential thinkers who pursued this quest in recent times. His book, The Design of Inquiring Systems, is an extensive, insightful, and engaging exploration of various approaches to understanding the production of knowledge and the most efficient ways of organizing this production (Churchman, 1971). It is certainly beyond the scope of this article to provide a detailed and exhaustive examination of Churchman’s ideas—an enterprise that would require a full book-length study. However, it is quite appropriate to engage some of the seminal themes of his works in the following reflections.

The theoretical perspective outlined in this article builds to a significant degree on major themes of Churchman’s heritage. It fully embraces his vision of progressively expanding nested levels and forms of organization that he sees as characteristic for inquiring systems. It is an inclusive vision of a democratic and cooperative process. In this regard, Churchman’s thinking about design of inquiring systems and the way they operate stands in sharp contrast to the prevalent practice in the contemporary scientific community.

As has been shown, the dominant conception of knowledge production in the scientific community does not recognize the role of the process of construction and does not incorporate this process. This failure has several consequences. First of all, without incorporating the process of construction, one cannot see the vital connection that always exists between the subject and the object. The world appears as ontologically divided by an unbridgeable gap. The discord between the realists and the anti-realists that plagues our intellectual community is a result of this division. This discord works against an objective and comprehensive understanding of reality, discourages critical introspection on both sides and ultimately hinders our scientific progress. The overall situation is disorienting for all involved. The failure to recognize the process of construction makes realists oblivious to the impact of subjectivity and leads to frequent uncritical projection of specific theoretical conceptions on reality. Insensitivity to the problem of subjectivity often tempts members of the scientific community to substitute their own theoretical perspective for reality. Claims that external reality fully validates theory merely conceal a triumphant subjectivism clad in the mantle of objectivity. The anti-realists do not fare much better and only add to overall theoretical confusion. Their emphasis on subjectivity merely renders all knowledge relativistic. In their case, reality appears as ultimately inaccessible to human reason. As one can see, both approaches are ultimately not conducive to a successful scientific enterprise.

The problem of validation is another important consequence of the failure to embrace the process of construction. Anti-realists simply dismiss this problem. In their view, all knowledge is relativistic—a view that leads to a facile conclusion that no knowledge is valid. By contrast, realists claim that knowledge can be validated by the reality external to our mind. Their approach also does not solve the problem. Human thought is by far the most powerful form of organization of reality. Because it is the most powerful form, are we justified in using other and much less powerful forms of organization to validate knowledge? The obvious answer is no. The less powerful forms cannot validate more powerful ones. They cannot fully encompass all the possibilities of these forms. Conversely, because of the greater power of symbolic operations, there are no obstacles that can, in principle, prevent establishing correspondence between thought and the reality external to our mind. Scientific theories of the past, such as flat Earth or the geocentric theory of the universe, were perfectly capable of establishing such one-to-one correspondence. Underdetermination also shows that pronouncing any theory to be a unique explanation of empirical data is ultimately a very problematic claim.

Churchman was keenly aware of the problem of validation or what he saw as the problem of the guarantor of the validity of knowledge (Churchman, 1971, pp. 274–75). In his efforts to resolve this problem, Churchman combined the legacy of American pragmatism and the intuition about syncretism of human intelligence that perceived an intimate connection between knowledge, on one hand, and ethical and aesthetic values, on the other. He sought to counter the relativistic implications of pragmatism by associating knowledge production with the pursuit of ideals, both ethical and aesthetic. (Ulrich, 2004). Although this approach opened new and very productive directions in Churchman’s quest, it ultimately has not resolve the problem of subjectivity and relativism. As he soberly acknowledged at the end of The Design of Inquiring Systems, the problem of the relationship between relativism and non-relativism still remained, in his view, the most important philosophical problem of the 20th century. (Churchman, 276).

Churchman’s most enduring legacy is his profound belief in human capacity to know—a capacity that is infinite and yet one that we can grasp and understand in its totality. He pursued this quest for objective and universal knowledge throughout his intellectual career. The perspective that centers on the process of construction follows up in this quest and seeks to shed new light on the problems of subjectivity, relativism, and objective and universal knowledge that Churchman confronted in his work.

The following observations may be a good starting point in addressing these problems. If, indeed, there is some dimension that allows observing reality in its entirety, we should have access to this dimension precisely because it must be truly universal and must include our activity. Also, if this dimension is truly universal, the knowledge we gain from this dimension should cover all the future forms of organization of reality and not just forms that exist now or have existed in the past. Finally, objectivity and universality requires that knowledge should critically incorporate the process of knowing, that is, the knower, or observer, should be part of knowing/observing.

The most essential characteristic of reality is its dynamic character. Reality never stands still; it constantly evolves, constantly creates new forms. We, humans, are one of the forms of organization of reality, and we are endowed with the same capacity for creating new forms as the rest of reality. Therefore, we do have full access to the most essential dimension of reality.

The past and the present of our universe is the story of the construction of new forms. We have every reason to believe that such continued construction will also be the future of our universe (unless, of course, we destroy ourselves). The fact that we can produce knowledge infinitely and that our knowledge is one of the forms of the organization of reality supports this view. Therefore, through understanding the process of construction, we, in a way, gain some knowledge about all forms that this process can create—past, present and future. We may not know in all details what specific forms this process and we will produce in the future, but, as this article argues, we can know how they will be produced.

Objective and universal knowledge should incorporate the activity of knowing, that is, the process of construction itself. In other words, it should include the observer/knower into the field of observation. However, how can we observe the process of construction and ourselves without entering into infinite regress? Observing the process of construction requires constructing a position from which this process can be observed. What such observational position requires seems impossible: to observe the process of construction, one must construct a position outside this process. However, how can one be outside the process of construction because taking such position also involves construction? How is it possible to be inside and outside the process at the same time? Is not this a contradiction? In other words, can one reflect on the process of construction itself?

As has been pointed out earlier, the process of construction involves regulation. Regulation is essentially a reflective function. The fact that the process of construction is infinite may suggest, as it does to Niklas Luhmann, that there is really no way to reflect on the process of construction because for every reflective position, there will always be a possibility of constructing another one (Luhmann, 1984, p. 479). Every point of reflection can and will be succeeded by another one, no less embedded in the process of observing/constructing than its predecessor. Should one conclude, then, that the problem of the embedded observer/knower cannot be resolved and all that is left is to rely on palliatives, such as Luhmann’s conditioning (Luhmann, 1984, p. 485)?

It is logically correct to regard, as Churchman has, the process of construction itself as a system. Just like any other system, it requires stabilization and, therefore, regulation that offers a possibility of reflection. If the process of construction requires regulation, there must exist a position from which one should be able to reflect on the entire process without at the same time being outside of this process.

As has been indicated earlier, conservation and regulation are at the heart of the process of construction. Conservation of functional operations requires regulation. At its inception, the regulatory operation is unstable. To stabilize itself, it needs its own regulatory operation that marks the inception of a new level of organization that also needs to be stabilized. Thus, the process of construction combines both equilibrium and disequilibrium. Both equilibrium and disequilibrium are dynamically related in the process of construction. An increase in equilibrium, or entropy, on one level of organization leads, at the same time, to an equal increase in disequilibrium, or order, because it generates a new and more powerful level of organization that regulates this level. This conception of the process of construction is in total agreement with the second law of thermodynamics that says that entropy can only be equal or more than zero (see Shkliarevsky, 2011). In the process of construction, the total amount of entropy is always zero as it constantly maintains a balance between equilibrium and disequilibrium.

The repetition of the cycle of construction eventually leads to the improvement of the function of regulation, and the process of construction becomes increasingly more stable, despite constant changes. One can probably best describe this dynamic stability as homeorhesis—the term that was introduced by the biologist Conrad Waddington—rather than homeostasis. Homeorhesis is not a static condition and, as such, requires a stable balance between equilibrium and disequilibrium. This dynamic balance has a function of regulation and, as a regulatory operation, offers a possibility of reflecting on the functioning of the system as a whole (Shkliarevsky, 2007).

The universal knowledge cannot be reduced to any particular product of the process of construction. There are no god particles. The search for a universal knowledge in this direction is utterly futile. Rather, the universal knowledge can only be about the common denominator that underlies all that have emerged, is emerging and will emerge in the future. It involves knowledge of the process of construction itself. This knowledge is not a lifeless abstraction that lies outside our daily experience. On the contrary, it is integrally connected to our life. We just have to know how to look to recognize this fact. Every phenomenon that we encounter is a product of the process of organization in its constant interplay between equilibrium and disequilibrium. Every level of organization of reality is a product of equilibration, and every equilibration creates disequilibrium. Observing reality from the vantage point of this delicate but very stable balance will include in our field of vision not only the particular phenomenon that we are trying to understand but also the knowledge of the universal process that made this and all past, present and future phenomena possible. This conclusion suggests that the current differentiation between epistemology and ontology is purely analytical. As this article suggests, ontology (i.e., what relates to being) and epistemology (i.e., what relates to knowing) are intimately connected because, despite isomorphic differences, the process of construction that underlies reality is structurally the same process that we use in constructing knowledge.

The perspective that incorporates the process of construction offers a different approach towards validating knowledge that is non-exclusive and, at the same time, non-relativistic. As has been indicated earlier, the combinatorial power is what distinguishes one level of organization of reality from another. Therefore, we can use combinatorial power—or in other words, inclusiveness—as the criterion for validating knowledge. The more inclusive a theory is, the greater is its combinatorial capacity and, therefore, the greater is its explanatory power. For example, non-Euclidean geometry includes Euclidean geometry as its particular case with the curvature equal to zero. Therefore, non-Euclidean geometry has greater explanatory power. It can operate with both flat and curved space.

This approach to validation demonstrates a vital aspect of knowledge production that resonates with Churchman’s view of cascading inquiring systems. Knowledge production is ultimately inclusive. Old theories are not discarded as a result of the adoption of new theories; preceding levels of organization are not obliterated as new ones emerge. On the contrary, old theoretical perspectives and their levels of organization are conserved in new and more comprehensive constructions. They merely become a particular case of a broader and more inclusive perspective. It is also a profoundly democratic approach. All knowledge is part of our quest, and no knowledge should be excluded. Legitimate disagreements should not trigger power struggle where one perspective seeks to de-legitimate and obliterate another. Rather, they should motivate a search for another, more inclusive and even orthogonal perspective that would dissolve the dissonance into a new harmony.

Such approach stands in stark contrast to the dominant current practice of knowledge production that tends to be exclusive. Dominant theoretical perspectives seek to silence alternatives. Control over funding, exposure, publishing and academic appointments provides ample opportunities to enforce orthodoxy. More often than not, knowledge production turns into an exercise of power.

The driving force in this exercise of power is fear. The exclusion of the process of construction from our conception of knowledge production often leads to uncritical projection of specific subjective interpretations on reality. Such uncritical projections foster an institutionally supported and proliferated illusion in which a particular theoretical perspective stands for the actual reality. Alternatives that compete with accepted standard models get little consideration or exposure. Research programs that choose to focus on other than mainstream approaches are not particularly high on the list of projects that receive funding.

Fetishization and absolutization of specific constructs is among some of the most adverse effects of the conception of knowledge production that excludes the process of construction. A limited one-sided consciousness impaired by this exclusion takes its own projections for a true reality. As the process of construction evolves and new forms and levels of organization of knowledge emerge, such consciousness experiences this legitimate process as a loss of reality.

There are few traumatic experiences that can compare to losing one’s ability to understand and interpret reality. For a consciousness that undergoes this experience, reality becomes a void, an abyss devoid of any meaning; or worse, filled with negative meaning. In words of Shakespeare, ‘time comes out of joints’. Such consciousness develops a sense of disorientation, confusion and fear. To make things worse, its capacity to cope with this condition is severely limited to only one cognitive operation—assimilation. Such consciousness is incapable of critically examining itself; it simply cannot see internal sources of its predicament. Rather, it takes an easier approach: it rejects the challengers and uses power to silence them. Thomas Kuhn has discerned the disruptive effects of such conflicts in his Structure of Scientific Revolution (Kuhn, 1970).

There is no rational justification for resistance to new forms and levels of organization. These changes do not destroy the old forms. They conserve them in broader and more comprehensive visions. When old forms are subject to pressure of change, we are not losing reality. On the contrary, it is precisely during these transitional moments that we experience the most direct and most intimate contact with the ultimate reality—the process of construction. The focus on the process of construction helps to understand that it is this process, its constant and unimpeded evolution, and not the specific forms it creates, that we should view as the only true and desirable product of our efforts.

The perspective that embraces the process of construction also recognizes, as Churchman has, the essential and necessary syncretism of all human mental activities—a profound connection between our capacity to create knowledge and our aesthetic and ethical values. Gratification of our functions is the source of pleasure and contentment. When we perform our essential functions—visual, audio, gustatory, tactile, and others—we exercise these functions and experience pleasure. A familiar face activates mental operations in the mind of a child. Exercising these mental operations gratifies and conserves these operations, and the child experiences a sense of pleasure and contentment, as he or she does when seeing a familiar face of the mother.

Construction of knowledge is the most essential human function. All humans are capable of performing this profoundly creative act. The fact that we all become conscious beings by the end of the first year of our lives is a compelling proof of this capacity. It is hard to overestimate the magnitude of this creative transformation. Nothing that we humans have or will accomplish—no theory of relativity or quantum mechanics— will ever exceed in its significance this act of creation. When we construct knowledge and perform acts of creation, we exercise our most essential human functions and, as a result, we, experience pleasure and contentment. It is this pleasure and gratification conferred by the act of creation that is the source of enjoyment that we associate with aesthetic value.

Construction of knowledge involves two basic operations—assimilation and adaptation. Assimilation is an operation that incorporates objects of reality into internal functional schemata of the organism. This operation reduces the multiple and diverse world to the internal functions of the organism. It is, to be sure, a violent operation that essentially denies any autonomy to the reality external to the organism. Devouring of one organism by another is a good example of this operation.

By contrast, adaptation adjusts internal functions of an organism to reality. Recognition of autonomy of the reality external to the organism is essential in this operation. Such recognition is the basis for the development of moral sentiment that grants autonomy and agency to other human beings in our moral universe. Thus, our capacity for constructing knowledge, that is, exercising both assimilation and adaptation, is closely related to our ability to function as moral beings in our universe. Piaget has noted this connection in his book The Moral Judgment of the Child (Piaget, 1965). His remark that ‘Logic is the morality of thought just as morality is the logic of human action’ is a poignant affirmation of the essential connection between knowledge and morality (Nicolopoulou and Weintraub, 1998, p. 222). We cannot get an objective view of reality if we insist on viewing reality on our terms, rather than on its own. Objective knowledge requires granting the same autonomy to reality and its objects that we grant to ourselves and others in our moral universe.

Our civilization firmly holds on to an inspiring belief that knowledge is the key to ensuring unimpeded progress, rational political order, economic prosperity, judicious use of natural resources and a world free of wars and violence (see, e.g., Banathy, 2000; McIntyre-Mills, 2010; McIntyre-Mills and De Vries, 2011). Both Churchman and Piaget, among many other thinkers, fully grasped the importance of understanding knowledge production for achieving these goals. By combining systems thinking with the constructivist approach, the perspective outlined in this paper largely builds on their legacy. Much has been carried out to understand the specific aspects of the process of construction, including works by this author (Shkliarevsky, 2007, 2008, 2010, 2011), but much still has to be learned. It is the hope of this author to contribute to further exploration of this important subject.

This paper has shown that the problem raised by Horgan in his book is not a fortuitous one. It is not due to ignorance, obscurantism or some insidious agenda. It is deeply rooted in the views on knowledge production, the relationship between subject and object, and our relation to reality—in a word, the philosophical worldview held by modern science. The resolution of this problem requires a critical rethinking of this worldview. This paper suggested some ways in which this worldview can be revised.

Fundamental revisions are not easy and are often resisted. There is a reason for such resistance. Conservation plays a crucial role in the process of construction. However, conservation inevitably requires regulation, and regulation leads to the emergence of new levels of organization. This process works in the universe, and it works in the world of man. We are its practitioners, and our creativity over the entire period of human history is a vivid testimony to this fact. This process has profoundly shaped our civilization and us. Our intimate relation to this process compels us to understand it. Such understanding will help us to practice it more efficiently and with fewer losses. However, most importantly, it will help us embrace our true destiny in shaping and reshaping reality in our infinite quest for knowledge.

ACKNOWLEDGEMENTS

I want to thank the two anonymous external reviewers for their engaged reading of the original draft, their provocative questioning of my ideas, and their most useful suggestions for revision. Their contribution has helped me a great deal to clarify my own thinking. This experience has been a wonderful example of cooperative and collaborative enterprise that one should expect from the community of the “republic of equals”.

  1. For reasons of convenience and economy, I provide a slightly abridged verbatim version.
  2. In philosophy of science, dualism often refers to the dichotomy between the ‘subject’ (the observer) and the ‘object’ (the observed). Criticism of Western science may label this kind of dualism as a flaw in the nature of science itself.

Link: http://onlinelibrary.wiley.com/doi/10.1002/sres.2127/full

 
 
Follow

Get every new post delivered to your Inbox.

Join 918 other followers